Movement Disorders
Vol. 19, No. 7, 2004, pp. 829 – 862
© 2004 Movement Disorder Society

Clinical/Scientific Notes

the diagnosis of thalamic haemorrhage secondary to anticoagulants was suggested. One week after stroke, clonic contractions
of the left side of his face appeared in association with permanent contraction of the right side. These movements abated
when the patient was asleep and increased with emotions. The
association of this bilateral facial dystonia and vertical gaze
palsy produced the aspect of a sardonic smile (Fig. 2A,B).
Magnetic resonance imaging (MRI) confirmed the diagnosis of
right thalamic haemorrhage but failed to find any associated
brainstem lesions. Electroencephalographic (EEG) recording
showed slow frontal waves without paroxysms, thus ruling out
epileptic discharges. Electromyographic (EMG) study revealed
a higher muscle tone in the facial muscles with superimposed
synchronous EMG bursts and disappearance of muscle tone as
arousal decreased (Fig. 3A–C). This bilateral facial dystonia
resolved spontaneously in 3 months.

Risus Sardonicus After Thalamic Haemorrhage
Igor Sibon, MD* and Pierre Burbaud, PhD
Fédération de Neurosciences Cliniques, Centre Hospitalier
Universitaire Bordeaux, Bordeaux, France
Abstract: We describe an uncommon movement disorder after
stroke. A 70-year-old man was admitted for a right thalamic
haemorrhage and 1 week later developed bilateral contractions
of the face. Electromyographic study revealed a bilateral facial
dystonia. The association of this bilateral facial dystonia and
vertical gaze palsy produced the aspect of a “risus sardonicus.”
© 2004 Movement Disorder Society
Key words: dystonia; thalamic lesion
Secondary dystonia is observed in a large spectrum of diseases
associated with basal ganglia lesions (for review, see Garcia de
Yebenes et al.1). In most cases, the lesions involve the posterior
putamen,2 and more rarely the caudate nucleus or pallidum.3
The role of the thalamus in the pathophysiology of secondary
dystonia remains unclear since the lesions can induce dystonia4
but they has also been used in the past, with some success, as
a surgical treatment for dystonia.5 Dystonia occurring after
thalamic lesions includes myoclonic dystonia predominating in
the hand with dystonic postures and slow pseudo-athetoid
movements. The lesions frequently encompass both the ventral
intermediate (Vim) and ventral caudal (Vc) nuclei of the thalamus.3,4,6,7 In addition, postural and action tremor has been
observed after lesions of the Vim.3 To our knowledge, dystonia
restricted to the lower face has not until now been observed
after vascular thalamic lesions. We report on a case of bilateral
tonic facial spasm leading to a “risus sardonicus” secondary to
a right thalamic haemorrhage.

Discussion
Hyperkinetic movement disorders are uncommon after
stroke (1%).8 They occur generally secondary to lesions of the
posterior putamen and more rarely to the caudate nucleus,
pallidum, or thalamus.2– 4 Among these disorders, late-onset
dystonia is the most frequent and appears after a delay ranging
from some weeks to several years.1 To explain this delay, a
sprouting of dendrites within the lenticular formation has been
hypothesised. In our case, the latency between stroke and
dystonia (1 week) was particularly short and suggested direct
involvement of the lesion in genesis of the movement disorder.
Although rarer, short-onset dystonia appearing immediately or
a few days after a thalamic lesion has been reported previously.4 An acute thalamic lesion could indeed disorganise the

Case Report
A 70-year-old man was admitted to the emergency unit for
sudden left-sided hemiplegia. Past medical history included
atrial fibrillation treated by anticoagulants and essential thrombocythemia treated by hydroxycarbamide (Hydrea). Initial clinical examination revealed flaccid hemiplegia, left-sided anaesthesia, a central facial palsy and left-sided lateral hemianopia,
vertical gaze palsy, dysarthria, and dysphagia. Cerebral computed tomography (CT) scan showed a right thalamic haemorrhage (Fig. 1). Serum biological parameters were normal and

*Correspondence to: Dr. I. Sibon, Service de Neurologie, Hopital
Pellegrin, Place Amélie Raba-Léon, 33076 Bordeaux cedex, France.
E-mail: igor.sibon@chu-bordeaux.fr
Received 12 June 2003; Revised 4 September 2003; Accepted 9
September 2003
Published online 19 March 2003 in Wiley InterScience (www.
interscience.wiley.com). DOI: 10.1002/mds.10675

FIG. 1. Cerebral CT scan found a right thalamic haemorrhage.

829

830

CLINICAL/SCIENTIFIC NOTES

FIG. 2. A, B: “Risus sardonicus.” The patient had bilateral facial dystonia with bilateral vertical gaze palsy.

subcortical inputs impinging on the premotor cortex. In an
experimental study carried out in the monkey, we found that
pharmacologic injections of bicuculline, a gamma aminobutyric acid (GABA) antagonist, into the motor thalamus induced

acute dystonia, the type of which depended on the site of
injection within the pallidal or motor segments.9,10 Moreover,
electrophysiological recordings carried out in primary dystonic
patients during surgery for deep brain stimulation have re-

FIG. 3. Electromyographic (EMG) data. A: Surface recordings in the right orbicularis oculi (R. Oc), right orbicularis oris (R. Or), left orbicularis
oculi (L. Oc), left orbicularis oris (L. Or). Increased tonus was observed at rest on both side but predominated on the left with superimposed myoclonic
bursts in the four muscles. B: Needle detection recordings on the left side; the patient is awake; note the myoclonic jerks. C: Same recording when
the patient is asleep; both the background of tonic activity and myoclonic jerks have disappeared.

Movement Disorders, Vol. 19, No. 7, 2004

CLINICAL/SCIENTIFIC NOTES
vealed an alteration in the pattern of thalamic neurone activity,
with a decrease in the discharge rate and a widespread response
to somatosensory inputs.11 This suggests that the focusing
processing of information originating from subcortical regions
is altered in dystonia. A common view is that this phenomenon
could induce overspreading of cortical activity leading to
dystonia.12
An unusual feature in our patient was that the dystonic
symptoms were restricted to the face mimicking the procerus
sign described in progressive supranuclear palsy (PSP).13 Facial dystonia is indeed a rare feature of secondary dystonia, at
least when associated with vascular lesions. The commonest
type involves the distal musculature as in hemichorea, hemiballism, or hemidystonia.8 A myoclonic component has been
reported frequently after thalamic lesions, sometimes in association with slow pseudo-athetoid movements.3,4,6 This is particularly true when the lesions are located in the posterior motor
thalamus, which is considered a relay for cerebellar inputs to
the cortex. In our case, the myoclonic jerks were located mainly
on the hemiface contralateral to the thalamic lesion but the
tonic spasm was bilateral. To our knowledge, only 1 case of
blepharospasm has been reported after vascular thalamic lesion4; the symptomatology was also bilateral whereas the lesion
was located in the right thalamus. In our case, however, the
dystonic spasm involved the lower part of the face. This suggests that a unilateral thalamic lesion might influence muscle
tone on both sides of the face. Our patient also exhibited
vertical gaze palsy. This has been reported previously after
unilateral thalamic infarction.14 The mechanism remains a matter of debate but could involve a dysfunction of either the
thalamocortical output or the brainstem through the reticular
formation controlling vertical gaze movements and facial motoneuron excitability.14,15
In conclusion, this observation suggests that “risus sardonicus” could be an uncommon presentation of secondary dystonia
due to a thalamic lesion.

References
1. Garcia de Yebenes J., Sanchez Pernaute R, Taberno C. Symptomatic dystonias. In: Watts RL, Keller WC, editors. Movement Disorders: neurologic principles and practice. UK: McGraw-Hill;
1997. p 455– 475.
2. Bhatia KP, Marsden CD. The behavioural and motor consequences
of focal lesions of the basal ganglia in man. Brain 1994;117:859 –
876.
3. Lehericy S, Vidailhet M, Dormont D, et al. Striatopallidal and
thalamic dystonia. A magnetic resonance imaging anatomoclinical
study. Arch Neurol 1996;53:241–250.
4. Lee MS, Marsden CD. Movement disorders following lesions of
the thalamus or subthalamic region. Mov Disord 1994;9:493–
507.
5. Cardoso F, Jankovic J, Grossman RG, Hamilton WJ. Outcome
after stereotactic thalamotomy for dystonia and hemiballismus.
Neurosurgery 1995;36:501–507.
6. Pettigrew LC, Jankovic J. Hemidystonia: a report of 22 patients
and a review of the literature. J Neurol Neurosurg Psychiatry
1985;48:650 – 657.
7. Lehericy S, Grand S, Pollak P, et al. Clinical characteristics and
topography of lesions in movement disorders due to thalamic
lesions. Neurology 2001;25;57:1055–1066.
8. Ghika-Schmid F, Ghika J, Regli F, Bogousslavsky J. Hyperkinetic
movement disorders during and after acute stroke: the Lausanne
Stroke Registry. J Neurol Sci 1997;146:109 –116.

831

9. Guehl D, Burbaud P, Boraud T, Bioulac B. Bicuculline injections
into the rostral and caudal motor thalamus of the monkey induce
different types of dystonia. Eur J Neurosci 2000;12:1033–1037.
10. Macia F, Escola L, Guehl D, Michelet T, Bioulac B, Burbaud P.
Neuronal activity in the monkey motor thalamus during bicuculline-induced dystonia. Eur J Neurosci 2002;15:1353–1362.
11. Vitek JL. Pathophysiology of dystonia: a neuronal model. Mov
Disord 2002;17(Suppl.):49 – 62.
12. Berardelli A, Rothwell JC, Hallett M, Thompson PD, Manfredi M,
Marsden CD. The pathophysiology of primary dystonia. Brain
1998;121:1195–1212.
13. Romano S, Colosimo C. Procerus sign in progressive supranuclear
palsy. Neurology 2001;57:1928.
14. Clark JM, Albers GW. Vertical gaze palsies from medial thalamic
infarction without midbrain involvement. Stroke 1995;26:1467–
1470.
15. Larumbe R, Vaamonde J, Artieda J, Zubieta JL, Obeso JA. Reflex
blepharospasm associated with bilateral basal ganglia lesion. Mov
Disord 1993;8:198 –200.

Long-Term Outcome of Clozapine Use for
Psychosis in Parkinsonian Patients
Hubert H. Fernandez, MD,* Edward M. Donnelly, MD,
and Joseph H. Friedman, MD
Department of Clinical Neurosciences, Brown University
School of Medicine, Providence, Rhode Island, USA
Abstract: A retrospective analysis was carried out on 39 parkinsonian patients on clozapine treatment ⱖ24 months for
psychosis. The cohort had a mean age of 76 years and an
average clozapine dose of 47 mg/day over 60 months of clozapine use. Of 39 patients, 13 (33%) patients were eventually
admitted to nursing homes, 6 (46%) of whom died over a
period of 5 years. The overall 5-year mortality rate in this
cohort was 44% (17/39). Of 39 patients, 33 (85%) had continued partial/good response and 5 (13%) had complete resolution
of psychosis. None discontinued clozapine due to motor worsening. Among patients who responded early on, the long-term
efficacy of clozapine for psychosis was sustained. The risk of
nursing home placement and mortality among parkinsonian
patients treated with clozapine for psychosis in this geriatric
cohort was better than that reported previously. Our data are
more consistent with recently published long-term outcome
data suggesting an improvement in the prognosis of parkinsonian patients with psychosis with the use of atypical antipsychotic agents such as clozapine. © 2004 Movement Disorder
Society
Key words: Parkinson’s disease; clozapine; drug-induced
psychosis; long-term efficacy

*Correspondence to: Dr. Hubert H. Fernandez, McKnight Brain
Institute, Department of Neurology, University of Florida, 100 S.
Newell Drive, PO Box 100236 Gainesville, FL 32610.
E-mail: fernandez@neurology.ufl.edu
Received 18 November 2002; Revised 17 June 2003, 20 November
2003; Accepted 1 December 2003
Published online 17 March 2004 in Wiley InterScience (www.
interscience.wiley.com). DOI: 10.1002/mds.20051

Movement Disorders, Vol. 19, No. 7, 2004

832

CLINICAL/SCIENTIFIC NOTES

Drug-induced psychosis is the single most important factor
precipitating nursing home (NH) placement,1,2 an often irreversible medical and social decision3 that carries a grave prognosis.4 Because of the lesser potential of atypical antipsychotic
drugs to worsen parkinsonism, they have taken on a central role
in the management of psychosis in Parkinson’s disease (PD).
To date, clozapine remains the “gold standard” atypical
antipsychotic agent. Short-term studies have shown that clozapine, with a mean dose of about 25 mg/day, improved psychosis without motor worsening.5,6 In fact, overall motor function
also improved slightly but tremor improved significantly.5
However, clozapine has been difficult to use because of its
potential for inducing agranulocytosis. The problem is idiosyncratic, so that even the small doses used in PD do not exempt
patients from this side effect.5
Recently, a task force that considered all peer-reviewed
reports on clozapine use in PD concluded that “low-dose clozapine is efficacious in the short-term improvement of psychosis in PD with acceptable risk with specialized monitoring but
there is insufficient evidence on its long-term efficacy.”7
We present our long-term data on parkinsonian patients on
chronic clozapine treatment for psychosis.

Patients and Methods
A retrospective analysis of all parkinsonian patients on longterm (ⱖ24 months) clozapine treatment for psychosis at our
Movement Disorders Center was carried out. Patients who were
treated with clozapine for tremor or dyskinesia, and patients
who discontinued clozapine before 24 months of use were not
included in this study. In general, clozapine was started at 6.25
mg at bedtime and increased by 6.25 to 12.5 mg every 3 to 7
days as needed until improvement of psychosis was noted.
Anti-PD medications were kept constant during the titration
phase but medication adjustments were permitted at any time
after the minimal effective clozapine dose was determined.
All significant side effects after 24 months of clozapine use,
as noted by the patient, caregiver or clinician, were recorded.
Only the baseline (before clozapine use) and latest Unified
Parkinson Disease Rating Scale (UPDRS) motor and Hoehn
and Yahr (H&Y) scale scores were used in the motor analysis.
Nursing home (NH) placement and mortality rates were used as
the endpoints.

Results
A total of 67 patients were placed on clozapine at our
Movement Disorders Center over the 5-year span of this survey. Of 67 parkinsonian patients, 39 were included in this
study. The remaining 28 patients were excluded because clozapine was used for nonpsychotic indications (n ⫽ 8) or was
discontinued within 24 months due to either lack of efficacy or
intolerable side effects (n ⫽ 20).
The cohort had a mean age of 76 years, average disease
duration of 14.2 years, and mean clozapine dose of 47 mg/day
for an average duration of 60 months of clozapine use.
Probable PD (defined as having at least two of three symptoms of: resting tremor, bradykinesia and rigidity; with a significant and sustained response to levodopa [L-dopa]) had been
diagnosed for 79% percent, 13% had probable dementia with
Lewy bodies (using the Consensus criteria8) and 7% had other
parkinsonian syndromes. Of 39 patients, 22 (56%) were demented; 13 of 39 (33%) patients were eventually admitted to

Movement Disorders, Vol. 19, No. 7, 2004

TABLE 1. List of side effects noted with
long-term clozapine use
Side effect

n (%)

Sedation
Drooling
Dry mouth
Constipation
Urinary frequency/incontinence
Hypothermia
Confusion

11/39 (28)
4/39 (10)
1/39 (2)
1/39 (2)
1/39 (2)
1/39 (2)
1/39 (2)

The above side effects were classified as “possibly” or “probably”
related to clozapine use as documented by the clinician in the patient’s
chart; some patients had more than one side effect.

NHs. Of the patients admitted to a NH, 6 (46%) died over a
5-year span. Overall, the 5-year mortality rate in this cohort
was 44% (17/39).
Of 39 patients, 33 (85%) had continued partial/good response and 5 (13%) had complete resolution of psychosis on
clozapine. There was no difference in efficacy between patients
admitted to the NH and those who remained at home (NH:
partial response ⫽ 11, complete ⫽ 2; community dwellers:
partial response ⫽ 23, complete ⫽ 3; ␹2 ⫽ 0.09; P ⬎ 0.25;
df ⫽ 1). A significant worsening in the mean UPDRS-motor
(39.4 vs. 45.7; P ⬍ 0.001) and H&Y scale (3.5 vs. 3.9; P ⫽
0.006) scores was noted over 60 months but none discontinued
clozapine due to motor worsening. The most common side
effects reported were excessive sedation (30%) and sialorrhea
(10%) (Table 1).
In the 5-year span of this survey, we are unaware of any case
of death due to myocarditis. Among all 67 patients placed on
clozapine over 5 years, in 2 cases clozapine treatment was
suspended temporarily due to transient leukopenia. These 2
patients were not part of this cohort. There were no cases of
agranulocytosis in our center.

Discussion
Although this long-term study is open and retrospective, it
represents a “real world” experience and supports the continued
safety and efficacy of clozapine for the treatment of psychosis
over a 5-year period, for patients who respond to clozapine
early on. Sedation and sialorrhea were the most common longterm side effects in this cohort.
The mild increase in UPDRS-motor scores over 5 years is
probably due to disease progression rather than clozapine because none of our patients complained of significant motor
worsening or discontinued clozapine due to increased parkinsonism.
One study showed that psychotic PD patients were over 13
times more at risk for NH placement compared with equally
debilitated nonpsychotic patients.1 Of those eventually admitted to the NH, 82% had hallucinations compared with only 5%
among patients who remained in the community. Moreover, in
a follow-up study, the 2-year mortality rate of PD residents
with psychosis admitted to the NH approached 100%.4
In our cohort, only 33% were eventually admitted to nursing
homes, of whom 44% died over a span of 5 years, a significantly improved NH placement and NH mortality rate compared with the that of the original 1995 report of Goetz and
Stebbins.4 The NH mortality rate in this cohort is closer to that

CLINICAL/SCIENTIFIC NOTES
of the more recently published longitudinal outcome of 59 PD
patients enrolled in a clozapine trial for drug-induced psychosis,9 showing a 2-year NH mortality rate of 28%. In the latter
study, the authors concluded that “it appears the prognosis (of
PD patients with drug-induced psychosis) has improved with
atypical antipsychotic therapy.” Our data support this statement.

Chorea-Acanthocytosis Associated
With Tourettism
Shinji Saiki, MD,1* Genjiro Hirose, MD,1
Koichiro Sakai, MD,1 Ichiro Matsunari, MD,2
Kotaro Higashi, MD,3 Misuzu Saiki, MD,1
Satoshi Kataoka, MD,1 Ariyuki Hori, MD,1
and Kohei Shimazaki, MD4

References
1. Goetz CG, Stebbins GT. Risk factors for nursing home placement in
advanced Parkinson’s disease. Neurology 1993;43:2227–2229.
2. Aarsland D, Larsen JP, Tandberg E, Laake K. Predictors of nursing
home placement in Parkinson’s disease: a population based prospective study. J Am Geriatr Soc 2000;48:938 –942.
3. Liu K, Manton KG. The characteristics and utilization pattern of an
admission cohort of nursing home patients. Gerontologist 1983;23:
92–98.
4. Goetz CG, Stebbins G. Mortality and hallucinations in nursing home
patients with advanced Parkinson’s disease. Neurology 1995;45:
669 – 671.
5. Parkinson Study Group. Low dose clozapine for the treatment of
drug-induced psychosis in Parkinson’s Disease. N Engl J Med
1999;340:757–763.
6. The French Clozapine Study Group. Clozapine in drug-induced
psychosis in Parkinson’s disease. Lancet 1999;353:2041–2042.
7. Goetz CG, Koller WC, Poewe W, et al. Management of Parkinson’s
disease: an evidence-based review. Mov Disord 2002;17(Suppl.):
120 –127.
8. McKeith IG, Fairbairn AF, Bothwell RA, Moore PB, Ferrier LN,
Thompson P, Perry RH. An evaluation of the predictive validity and
inter-rater reliability of clinical diagnostic criteria for senile dementia of Lewy body type. Neurology 1994;44:872– 877.
9. Factor SA, Feustel PJ, Friedman JH, Comella CL, Goetz CG,
Kurlan R, Parsa M, Pfeiffer R. Longitudinal outcome of Parkinson’s
disease patients with psychosis. Neurology 2003;60:1756 –1761.

833

1

Department of Neurology, Kanazawa Medical University,
Ishikawa, Japan
2
The Medical and Pharmacological Research Center
Foundation, Ishikawa, Japan
3
Department of Radiology, Kanazawa Medical University,
Ishikawa, Japan
4
Department of Internal Medicine, Hamano-nishi Hospital,
Ishikawa, Japan

Abstract: We report on a case of Chorea-acanthocytosis
(ChAc) in association with Tourettism that consisted of motor
and vocal tics, attention deficit– hyperactivity disorder, and
obsessive– compulsive disorder in addition to the typical symptoms of ChAc. The subject was compared with his elder sister
who had the same disease but milder clinical profile and neuroradiological findings. The [18F]-2-fluoro-2-deoxyglucose
positron emission tomography (FDG-PET) findings did not
explain the differences in symptomatology between the patient
and his sister, although they may have correlated with severity.
© 2004 Movement Disorder Society
Key words: chorea-acanthocytosis; tourettism; striatal hypometabolism
Although autosomal dominant and recessive, X-linked (termed
“McLeod syndrome”), and sporadic forms of chorea-acanthocytosis (ChAc) or neuroacanthocytosis have all been reported,
the clinical phenotypes are very similar in all of them.1 Recently, a novel gene (named CHAC) responsible for autosomal
recessive ChAc (AR-ChAc) has been identified.2– 4
Typical movement disorders associated with ChAc are choreiform movements, defined as random, irregular, involuntary
movements of the trunk and limbs.1 Although patients with
ChAc presenting with tourettism have been reported,5,6 the
symptoms have not been well detailed. We present a patient
with ChAc showing typical tourettism including phonic and

This article includes Supplementary Video, available online at http://
www.interscience.wiley.com/jpages/0885-3185/suppmat
*Correspondence to: Dr. Shinji Saiki, Department of Neurology,
Kanazawa Medical University, 1-1 Daigaku, Uchinada, Kahoku, Ishikawa, 920-0293, Japan.
E-mail: saibon@kanazawa-med.ac.jp
Received 7 July 2003; Revised 18 October 2003; Accepted 1 December 2003
Published online 4 March 2004 in Wiley InterScience (www.
interscience.wiley.com). DOI: 10.1002/mds.20050

Movement Disorders, Vol. 19, No. 7, 2004

834

CLINICAL/SCIENTIFIC NOTES

motor tics, along with attention deficit– hyperactivity disorder
(ADHD) and obsessive– compulsive disorder (OCD).

Case Reports
Case 1
A 34-year-old man suffering involuntary movements and
seizures was admitted to our service. The second child of
non-consanguineous parents, his gestation, delivery, and early
developmental milestones had been unremarkable. Family history was remarkable; his mother was clinically normal with no
acanthocytes, but his father had choreoathetosis and was diagnosed as ChAc and died of gallbladder cancer at age 50. His
paternal grandfather who died at age 62 had chorea and ballism
with onset in his early 30s. Two paternal aunts (with chorea and
tics) and a cousin (with choreoathetosis and ballism) were also
diagnosed as ChAc, and have been reported previously.7 His
sister (Case 2) had symptoms similar to his but milder (see
below). The patient was well until age 25 years when he had his
first seizure. No prior history of chorea, tics, ADHD, or OCD
was noted. Thereafter, he experienced orolingual movements
with self-mutilation of the lips and tongue, and soon suffered
rapid involuntary movements of his upper limbs. These movements gradually affected his lower limbs, neck, and trunk. At
age 31 he began to show motor tics such as clapping his hands,
rotating his shoulders and body, and occasionally producing
snoring sound and squeals. Although he had worked as a
plumber since age 19, he lost his job because he often had
difficulty sustaining attention. At age 33 he started to have
difficulty in holding onto things and fell frequently. Furthermore, he began to repetitively check his wallet, make lists, and
pick his nose until it bled.
Physical examination was unremarkable, except for a partial
defect of the lower lip and many scratches on his extremities.
Neurological examination revealed mild dementia and disturbance of recent memory. On the Mini-Mental State Examination (MMSE), he scored 24 out of 30. Speech was normal
except for occasional explosive or involuntary sounds such as
“Yes, yes” and “Ah, ah” together with rapid head turning and
hand clapping. Word reiteration, such as “Thank you, thank
you” and “What is the name of a disease? What is the name of
a disease?” was frequent. He exhibited compulsive scratching
the skin of the extremities. He showed frequent orolingual
hyperkinesia, and had characteristics of hyperactivity manifested by fidgeting, talking excessively, and a tendency to
repeat questions before answers had been completed (see
Video, Segment 1). Abnormal involuntary movement scale
(AIMS) score8 was 40 out of 42. He was diagnosed with
ADHD and OCD based on the Diagnostic and Statistical Manual of Mental Disorders, except for the age of onset.9,10 He used
a wheelchair due to back-and-forth rocking movements. Cranial nerve functions were intact. Motor power was 5 of 5, but
muscle tone was markedly hypotonic in all limbs. Mild muscular atrophy of the legs was noted. His sensory examination
was normal and deep tendon reflexes were hypoactive with
flexor plantar responses. Neither ataxia nor dysmetria was
found in finger-to-nose and heel-to-shin tests.
Hematological examination detected no abnormalities, except for a hematocrit of 37.8%. Numerous acanthocytes (10 –
20%) were present on a peripheral smear. Blood chemical test
results were aspartate aminotransferase 48 U/l (normal values,

Movement Disorders, Vol. 19, No. 7, 2004

TABLE 1. Striatal metabolic ratio of FDG-PET
Structure
Caudate/cerebellum
Right
Left
Putamen/cerebellum
Right
Left

Case 1

Case 2

0.477
0.571

0.585
0.574

0.628
0.731

0.811
0.803

FDG-PET, [18F]-2-fluoro-2-deoxyglucose positron emission tomography.

11–34), alanine aminotransferase 35 U/l (normal, 4 –37), lactate dehydrogenase 485 U/l (normal, 132–248), creatine kinase
1,179 U/l (normal, 47–212), and aldolase 11.0 U/l (normal,
1.8 – 6.1). Urinalysis, serum electrolytes, very low-density and
low-density serum lipoprotein, and serum ceruloplasmin were
all within normal ranges. Chest and skull radiographs and an
electrocardiogram were unremarkable. Cell counts, protein, and
sugar in the cerebrospinal fluid were all within normal limits.
Nerve conduction velocity studies showed inexcitability of the
left peroneal nerve, but the rest of the nerves had normal
velocities. Left biceps brachii muscle biopsy showed variable
fiber diameters. Electroencephalography was normal. Brain
magnetic resonance imaging (MRI) detected marked atrophy of
the bilateral striatum (Fig. 1A). [18F]-2-fluoro-2-deoxyglucose
positron emission tomography (FDG-PET) scans showed
marked hypometabolism of the striatum and mild hypometabolism of the frontal cortex (Fig. 1B). The ratios of caudate to
cerebellum and of putamen to cerebellum indicate that the
patient also had decreased metabolism in the basal ganglia,
similar to that of his sister (Case 2), but the degree of his
hypometabolism was much more severe (Table 1). Furthermore, we detected a novel single heterozygous mutation of the
CHAC gene in both.7
He was been treated with oral haloperidol (2.25 mg/day) and
showed marked amelioration of his involuntary movements and
tourettism over a 6-month period. His AIMS score decreased to
27 of 42.

Case 2
The elder sister of the proband developed involuntary movements (see Video, Segment 2) (orofacial dyskinesia, jerking of
the head, and chorea in the extremities) at age 35. One year
later, she also had phonic and motor tics, but not ADHD or
OCD. She showed orofacial dyskinesia and choreic movements
of the extremities. Her AIMS score was 15 of 42. No amyotrophy was noted. On both direct smears and wet preparations,
10 to 15% of erythrocytes were acanthocytes. Brain MRI
revealed atrophy of the striatum; atrophy of the bilateral striatum was almost equal to Case 1. FDG-PET scans showed
marked hypometabolism of the striatum (Table 1) and mild
hypometabolism of the frontal cortex.

Discussion
We diagnosed both siblings as ChAc based on clinical symptoms, family history, and gene abnormalities. A diagnosis of
Tourette syndrome (TS) should be based on a patient’s history
and whether there are motor or phonic tics, the presence of
coexisting behavioral disorders, such as ADHD and OCD, and

CLINICAL/SCIENTIFIC NOTES

835

FIG. 1. Brain MRI showing striatal atrophy and FDG-PET showing hypometabolism. A: Brain T2-weighted MR (1.5 T, TR/TE ⫽ 4500/9.6) image
showing marked atrophy of the bilateral caudate nucleus and heterogeneous intensity of the bilateral putamen. B: FDG-PET study showing marked
hypometabolism of the bilateral caudate, putamen, and frontal cortices.

any family history of similar symptoms.11 The term “tourettism” has used to describe TS-like symptoms secondary to
some specific cause.12 Our patient had motor and vocal tics
associated with meaningless echolalia but without coprolalia,
similar to reported findings.5,6 He also displayed typical ADHD
and OCD symptoms. He is not likely to have been coincidentally suffering from ChAc and idiopathic TS, because of the
unusual age of onset and the negative family history of TS and
related symptoms. The patient did not present initially with
tourettism, but it was a later manifestation of his ChAc.
FDG-PET investigations in ChAc patients have shown reductions in glucose metabolism in caudate, putamen, and frontal cortex.13,14 Dubinsky and colleagues14 reported that clinical
severity was correlated with the decrease in the basal ganglial
metabolism in 2 siblings with ChAc; our FDG-PET results
concur.
Based on findings of various biochemical, neuroimaging,
neurophysiological, and genetic studies, TS is now considered
an inherited, developmental disorder of synaptic neurotransmission that results in disinhibition of the cortico-striatothalamo-cortical circuitry.15 Although many studies using
FDG-PET have shown hypometabolism of the basal ganglia in
TS, it remains unclear whether frontal hypometabolism is associated with the pathomechanism of TS or not.15 Chase and
associates16 found an inverse correlation between severity of
tics (both vocal and motor) and glucose utilization rates in the
frontal, cingulated and insular cortices, and in the inferior
corpus striatum in TS. The FDG-PET findings in our study do
not explain the difference in symptomatology between the
patient and his sister, although they may correlate with severity.

Although the proband’s clinical symptoms were typical of
chorea and tourettism, his sister, who suffered from the same
disease and shared the same gene mutation, had milder motor
tics; differing clinical features have already been observed in
this family.7 Although it is unclear whether such variable
clinical presentations are the result of genetic heterogeneity or
clinical variability, we speculate that clinical variability is not
the result of genetic heterogeneity at the major locus, but may
reflect other epigenetic interactions, contributing environmental factors, or both.

Legend to the Video
Segment 1. The patient (Case 1) has rapid, jerky movements of the neck, trunk, and extremities. Occasional finger and
hand movements and facial grimacing also occur. During conversation, he occasionally repeats the same phrases, such as
“Thank you” and “What did you say?” He is not able to sit on
the bed quietly because of his hyperactivity. He blurts out a
repetitive question, “What is the name of a disease?”
Segment 2. The patient (Case 2) shows random jerky movements and extension of the lower extremities and orofacial
dyskinesia.

References
1. Rampoldi L, Danek A, Monaco AP. Clinical features and molecular bases of neuroacanthocytosis. J Mol Med 2002;80:475– 491.
2. Rampoldi L, Dobson-Stone C, Rubio LP, et al. A conserved
sorting-associated protein is mutant in chorea-acanthocytosis. Nat
Genet 2001:28:119 –120.

Movement Disorders, Vol. 19, No. 7, 2004

836

CLINICAL/SCIENTIFIC NOTES

3. Ueno S, Maruki Y, Nakamura M, et al. The gene encoding a newly
discovered protein, chorein, is mutated in chorea-acanthocytosis.
Nature Genet 2001;28:121–122.
4. Dobson-Stone C, Danek A, Rampoldi L, et al. Mutational spectrum
of the CHAC gene in patients with chorea-acanthocytosis. Eur J
Hum Genet 2002;10:773–781.
5. Spitz MC, Jankovic J, Killian JM. Familial tic disorder, parkinsonism, motor neuron disease, and acanthocytosis: a new syndrome. Neurology 1985;35:366 –370.
6. Kito S, Itoga E, Hiroshige Y, Matsumoto N, Miwa S. A pedigree
of amyotrophic chorea with acanthocytosis. Arch Neurol 1980;37:
514 –517.
7. Saiki S, Sakai K, Kitagawa Y, Saiki M, Kataoka S, Hirose G.
Mutation in the CHAC gene in a family of autosomal dominant
chorea-acanthocytosis. Neurology 2003;61:1614 –1616.
8. Guy, W. ECDEU assessment manual for psychopharmacology.
DHEW publication, No. 76 –338. Washington, DC: U.S. Government Printing Office; 1976. p 534 –537.
9. American Psychiatric Association. Diagnostic and statistical manual of mental disorders. DSM-IV, 4th ed. Washington, DC: American Psychiatric Association; 1994. p 85–93.
10. American Psychiatric Association. Diagnostic and statistical manual of mental disorders. DSM-IV, 4th ed. Washington, DC: American Psychiatric Association; 1994. p 456 – 463.
11. Jankovic J. Tourette’s syndrome. N Engl J Med 2001;345:1184 –
1192.
12. Sacks OW. Acquired tourettism in adult life. Adv Neurol 1982;
35:89 –92.
13. Tanaka M, Hirai S, Kondo S, et al. Cerebral hypoperfusion and
hypometabolism with altered striatal signal intensity in choreaacanthocytosis: a combined PET and MRI study. Mov Disord
1998;13:100 –107.
14. Dubinsky RM, Hallett M, Levey R, Chiro GD. Regional brain
glucose metabolism in neuroacanthocytosis. Neurology 1989;39:
1253–1255.
15. Peterson BS. Neuroimaging studies of Tourette syndrome: a decade of progress. Adv Neurol 2001;85:179 –196.
16. Chase TN, Geoffrey V, Gillespie M, Burrows GH. Structural and
functional studies of Gilles de la Tourette syndrome. Rev Neurol
1986;142:851– 855.

Vascular Hemichorea/Hemiballism and
Topiramate
Emilia Mabel Gatto, MD,* Claudia Uribe Roca, MD,
Gabriela Raina, MD, Marcelo Gorja, MD, Silvia Folgar, MD,
and Federico E. Micheli, MD
Parkinson’s Disease and Movement Disorders Program,
Department of Neurosciences, Hospital de Clı́nicas,
University of Buenos Aires, Buenos Aires, Argentina

Abstract: Although vascular hemichorea/hemiballism (HC/
HB) has been reported to be self-limited, in some cases, it can
be irreversible and severely disabling. The standard treatment
includes typical and atypical neuroleptics and GABA-mimetic
drugs. Topiramate is a new antiepileptic drug possessing a
complex mechanism of action, including the enhancement of
GABA-mediated inhibition. We describe a 71-year-old patient
with HC/HB who markedly improved after topiramate treatment. © 2004 Movement Disorder Society
Key words: hemichorea; hemiballism; topiramate
Hemichorea (HC) features random and fast jerking, involuntary
movements of the limbs that mimic a dance confined to one
side of the body. When movements are wider and more violent
with prominent involvement of proximal muscles, it is termed
hemiballism (HB).1 These two clinical syndromes are currently
considered a continuum rather than two different entities, leading Kase and colleagues to propose the name hemichorea/
hemiballism (HC/HB) as a combination of both.2 The most
frequent etiology in adults is an acute cerebrovascular accident,
usually located in the contralateral basal ganglia.3 Although
spontaneous recovery usually occurs, in some cases HC/HB
can be disabling and irreversible.3 Typical high-potency neuroleptics, such as haloperidol, perphenazine, as well as other
antidopaminergic drugs, are the medication of first choice.4 As
HC/HB is more frequent in the elderly, a population particularly prone to develop parkinsonism and tardive dyskinesia on
neuroleptic therapy, it appears reasonable to test new therapeutic strategies. Over the past few years, various anticonvulsants
that increase ␥-aminobutyric acid (GABA)-ergic transmission
(valproate,5 gabapentin6) have been reported to be useful in the
management of isolated HC/HB cases. Topiramate (TPM) is a
new antiepileptic drug with several pharmacological actions,
including GABA activity enhancement.7 Here, we report on a

This article includes Supplementary Video, available online at http://
interscience.wiley.com/jpages/0885-3185/suppmat
*Correspondence to: Emilia M. Gatto, Juramento 1155, 3°A, Capital
Federal, Buenos Aires, 1428 Argentina.
E-mail: emiliagatto@fibertel.com.ar
Received 20 May 2003; Revised 13 September 2003; Accepted 5
December 2003
Published online 4 March 2004 in Wiley InterScience (www.
interscience.wiley.com). DOI: 10.1002/mds.20086

Movement Disorders, Vol. 19, No. 7, 2004

CLINICAL/SCIENTIFIC NOTES
71-year-old man who developed a vascular HC/HB effectively
treated with low doses of TPM.

Case Report
A 71-year-old man consulted at our department in May 2001
complaining of paresthesias involving his left arm followed by
the sudden appearance of abnormal and continuous movements
involving his left hemibody. His medical history included
chronic motor tics involving his left facial muscles since the
age of 15 and a peripheral by-pass surgery. The patient had
initially been evaluated at another center where he was started
on haloperidol 5 mg/day for only 3 days, followed by olanzapine 15 mg/day for another 4 days. No optimal doses were
achieved in either case because the patient reported subjective
worsening of the symptoms after haloperidol intake and somnolence with olanzapine. However, no medical records were
available to confirm this situation. These drugs, therefore, were
discontinued. Low-dose clonazepam (1 mg/day) was initiated,
with poor control of involuntary movements but with improvement of anxiety symptoms. Three months later, he was admitted to our center for a complete diagnostic evaluation. Neurological examination revealed an oriented patient with choreic
and sporadic ballistic movements affecting the left arm and leg,
without evidence of motor deficit. He presented mild hypoesthesia localized in his left hand with ipsilateral dysdiadochokinesia. Saccadic ocular movements were normal. He had mild
dysarthria, and normal muscle tone and deep tendon reflexes.
Laboratory findings were normal, including glycemia and thyroid function tests. A brain magnetic resonance imaging (MRI)
scan disclosed multiple hyperintense signals in T2-weighted
sequence located in the deep white matter and basal ganglia.
Doppler ultrasonography of cervical arteries and a cerebral MR
angiography demonstrated severe stenosis of the right internal
carotid artery. He was still on clonazepam 1 mg/day (see
Video, Segment 1). Because the patient refused to reinitiate
haloperidol or any other neuroleptic drug, a GABAergic agonist drug, TPM, was started at 25 mg/day and titrated weekly to
obtain the maximal benefit on HC/HB or the appearance of
intolerance, to a maximum of 400 mg/day. TPM doses were
increased by 25 mg per week, with improvement of HC/HB
from the very first week. Forty-eight hours after TPM 50
mg/day, involuntary movements markedly diminished (see
Video, Segment 2). The following week, upon reaching doses
of 75 mg/day, choreic movements were sporadic and mild in
intensity, enough so that he was able to perform fine motor
tasks as threading a needle. He simultaneously noticed irritability and reappearance of anxiety, but these side effects disappeared when he returned to 50 mg/day. The patient remained
with good control of HC/HB symptoms for 2 months. To
evaluate whether improvement of HC/HB had been due to the
spontaneous recovery of his disease, or if it had been associated
to the pharmacological intervention, TPM was gradually withdrawn over 5 days. Twenty-four hours after the drug was
withdrawn, mild but persistent left HC/HB was evident. A
second clinical evaluation performed 13 days after TPM withdrawal showed significant worsening of his HC/HB syndrome.
TPM was reinitiated and an objective clinical improvement was
achieved again 24 to 48 hours once TPM was restarted on 50
mg/day. However, although he reached doses of 50 mg/day, this
time he failed to improve to the level he had experienced during
the first course of treatment with TPM (see Video, Segment 3). A
second attempt to diminish TPM dose 1 month later led to a

837

recurrence and exacerbation of his symptoms. To date, he is still
on TPM 50 mg/day, with partial control of the HC/HB. In the
follow-up, a right carotid endarterectomy was performed but the
involuntary movements remained unchanged.

Discussion
Our patient presented an HC/HB syndrome secondary to a
probable vascular etiology. This theory was supported by the
acute onset of symptoms and evidence of peripheral and cerebral vascular disease. Although brain MRI failed to disclose
any acute infarction, this is not an infrequent situation found in
vascular choreas.8 Indeed, recent reports show that, in over
20% of cases, such lesions are not detected by conventional
neuroimaging techniques.9
Although the pathophysiology of HC/HB remains controversial, it has been postulated that the hyperkinetic disorder is caused
by decreased GABAergic transmission in the indirect basal ganglion pathway.10,11 In agreement with this hypothesis, experimental models of HC have been produced by injection of a GABA
antagonist drug into the external segment of the globus pallidus or
subthalamic nucleus.12 In the past few years, human single photon
emission computed tomographic studies12,13 have revealed increased blood flow in the thalamus contralateral to the choreic
movements after ischemic stroke compromising the basal ganglia,
which might reflect enhanced thalamic neuronal activity, free from
inhibitory pallidal control.12
Consistent with the lack of GABA transmission in HC/HB,
it seems reasonable to use drugs that increase GABAergic
neurotransmission. TPM has been proven to enhance GABA
activity7 and to be effective in the control of other movement
disorders such as essential tremor.14,15 We therefore decided in
the present case to explore the potential benefits of this drug in
the management of HC/HB in a patient who initially refused to
reinitiate neuroleptic therapy. Low doses of TPM (50 mg/day)
were initially well tolerated and markedly reduced HC/HB,
although the best clinical response was transient. Although
vascular HC/HB may spontaneously resolve,16 in our patient,
the worsening of symptoms within 24 hours after TPM was
withdrawn and the control of hyperkinetic movements after
re-initiation provide strong evidence of TPM efficacy.
On the other hand, there is no clear explanation for the
reduction in efficacy after re-introduction of TPM. Unfortunately, high doses could not be tested because of the development of irritability and increased anxiety with 75 mg/day. TPM
side effects include weight loss, paresthesias, memory problems, and neurotoxic effects (ataxia, impaired concentration,
confusion, dizziness, and somnolence). These side effects may
be due to the rate of titration or dose-related, as seems to have
occurred in our patient, who developed anxiety and irritability
that disappeared after diminishing the daily dose of TPM.17
Although the report of a single case remains essentially
anecdotal, we believe that it would be useful to explore the
potential benefits of TPM in the management of HC/HB, given
the theoretical bases that support its use in the treatment of this
entity. Our findings need to be corroborated by well-designed
trials to allow therapeutically valid recommendations.
Acknowledgment: The authors state that there is no financial relationship with pharmaceutical companies.

Legends to the Video
Segment 1. Baseline on clonazepam 1 mg/day.

Movement Disorders, Vol. 19, No. 7, 2004

838

CLINICAL/SCIENTIFIC NOTES

Segment 2. Marked improvement can be observed when the
patient received 1 mg/day of clonazepam and TPM 50 mg/day.
Segment 3. Choreic movements after 6 months. TPM 50
mg/day and clonazepam 1 mg/day.

References
1. Lang AE. Movement disorder symptomatology. In: Bradley WG,
Daroff RB, Fenichel GM, Marsden CD, editors. Neurology in
clinical practice. Boston: Butterworth-Heinemann; 1996. p 299 –
320.
2. Kase CS, Maulsby GO, De Juan E, Mohr JP. Hemichorea-hemiballism and lacunar infarction in the basal ganglia. Neurology
1981;31:452– 455.
3. Dewey RB, Jankovich J. Hemiballism-hemichorea: clinical and
pharmacological findings in 21 patients. Arch Neurol 1989;46:
862– 867.
4. Johnson WG, Fahn S. Treatment of vascular hemiballism and
hemichorea. Neurology 1977;27:634 – 636.
5. Sethi KD, Patel BP. Inconsistent response to divalproex sodium in
hemichorea/ hemiballism. Neurology 1990;40:1630 –1631.
6. Kothare SV, Pollack P, Kulberg AG, Ravin PD. Gabapentin treatment in a child with delayed-onset hemichorea/ hemiballismus.
Pediatr Neurol 2000;22:68 –71.
7. Shank RP, Gardocki JF, Streeter AJ, Maryanoff BE. An overview of
the preclinical aspects of topiramate: pharmacology, pharmacokinetics, and mechanism of action. Epilepsia 2000;41(Suppl. 1):S3–S9.
8. Piccolo I, Defanti CA, Soliveri P, Volonté MA, Cislaghi G, Girotti
F. Cause and course in a series of patients with sporadic chorea.
J Neurol 2003;250:429 – 435.
9. Galian R, Juni J, Castillo A, Parra J, Peiro C, Sancho J. Vascular
hemichorea: clinical-radiological correlation. Rev Neurol 2000;30:
409 – 411.
10. Hashimoto T, Morita H, Tada T, Maruyama T, Yamada Y, Ikeda
S. Neuronal activity in the globus pallidus in chorea caused by
striatal lacunar infarction. Ann Neurol 2001;50:528 –531.
11. De Long MR. Primate models of movement disorders of basal
ganglia origin. Trends Neurosci 1990;40:281–285.
12. Kim JS, Lee KS, Kim YI, Kim BS, Chung YA, Chung SK.
Evidence of thalamic disinhibition in patients with hemichorea:
semiquantitative analysis using SPECT. J Neurol Neurosurg Psychiatry 2002;72:329 –333.
13. Pantano P, DiCesare S, Ricci M, Gualdi GF, Sabatini U, Di Piero
V. Hemichorea after a striatal ischemic lesion: evidence of thalamic disinhibition using a single-photon emission computed tomography: a case report. Mov Disord 1996;11:444 – 447.
14. Connor GS. A double-blind placebo-controlled trial of topiramate
treatment for essential tremor. Neurology 2002;59:132–134.
15. Connor GS. Topiramate as a novel treatment for essential tremor.
Mov Disord 1999;14:908.
16. Ghika-Schmid F, Ghika J, Regli F, Bogousslavsky J. Hyperkinetic
movement disorders during and after acute stroke: the Lausanne
Stroke Registry. J Neurol Sci 1997;146:109 –116.
17. Glauser TA. Topiramate. Epilepsia 1999;40:985–991.

Mistaken Diagnosis of Psychogenic Gait
Disorder in a Man With Status Cataplecticus
(“Limp Man Syndrome”)
David K. Simon, MD, PhD,1* Seiji Nishino, MD, PhD,2
and Thomas E. Scammell, MD1
1

Beth Israel Deaconess Medical Center and Harvard
Medical School, Department of Neurology,
Boston, Massachusetts, USA
2
Center for Narcolepsy, Stanford University,
Palo Alto, California, USA

Abstract: We report on a 45-year-old man with a history of
multiple psychiatric admissions for a gait disorder and episodic
weakness thought to be psychogenic who was subsequently
diagnosed with status cataplecticus due to narcolepsy. The gait
difficulties resolved with venlafaxine. This case demonstrates
that status cataplecticus can be misdiagnosed as a psychogenic
gait disorder. © 2004 Movement Disorder Society
Key words: cataplexy; narcolepsy; hypocretin
Psychogenic gait disorders can be extremely challenging to
diagnose. Clinical features often include exaggerated effort,
extreme slowness, fluctuations, and bizarre gait with “uneconomic postures.”1–3 The diagnosis also is supported by a lack of
objective findings such as abnormal deep tendon reflexes or
tone. Here, we report a patient with features suggestive of a
psychogenic gait disorder that was actually caused by continuous cataplexy, or “limp man syndrome.”

Case Report
A 45-year-old man presented to the neurology clinic for
variable weakness, sleepiness, and visual hallucinations. Four
months earlier, he developed excessive sleepiness, especially
when sedentary, although he fell asleep once during public
speaking. Within a few weeks, he also began to have episodes
of sudden left leg weakness lasting approximately 1 minute and
occurring several times each day. In subsequent weeks, the
weakness spread to involve all extremities as well as the face,
neck, and voice. The duration of the episodes increased, ranging from a few minutes to several hours. A few weeks later, he
complained of visual hallucinations such as birds flying at his
face or thugs trying to attack him. Areflexia was noted on

This article includes Supplementary Video, available online at http://
www.interscience.wiley.com/jpages/0885-3185/suppmat
*Correspondence to: Dr. David K. Simon, Beth Israel Deaconess
Medical Center and Harvard Medical School, Department of Neurology, 77 Avenue Louis Pasteur, Room HIM-856; Boston, MA 02115.
E-mail: dsimon1@bidmc.harvard.edu
Received 27 August 2003; Revised 16 November 2003; Accepted 16
December 2003
Published online 16 March 2004 in Wiley InterScience (www.
interscience.wiley.com). DOI: 10.1002/mds.20078

Movement Disorders, Vol. 19, No. 7, 2004

CLINICAL/SCIENTIFIC NOTES
records from that time period. There was no family history of
neurological, psychiatric, or sleep disorders. Neuropsychiatric
testing revealed variably poor attention. A routine electroencephalogram was read as normal. Magnetic resonance imaging
of the brain with and without gadolinium and of the entire spine
(without gadolinium) were reported to be normal. Nerve conduction studies with electromyography showed only equivocal
findings on repetitive stimulation. A trial of pyridostigmine
bromide produced no clinical benefits. Computed tomography
of the chest was normal and acetylcholine receptor antibodies
were absent. He was diagnosed with a conversion reaction,
leading to two hospitalizations on a psychiatric service. He was
not medicated for these symptoms.
Additional history obtained at presentation indicated that
many of the episodes of weakness were triggered by strong
emotions such as excitement, anger, or laughter. He experienced weakness most of the time, with occasional periods of
normal power lasting up to 30 minutes. He had a history of
chronic daytime sleepiness over the past 4 months with frequent brief naps during the daytime associated with vivid
dreams and visual hallucinations. He reported frequent awakenings at night and his girlfriend noticed occasional apneic
episodes.
On examination, he was noted to be mildly overweight. He
was variably alert and attentive but for most of the examination
was observed to have slow and rambling speech. At these
times, he displayed ptosis, neck extensor weakness, and dysarthria. He remained awake and was able to talk but reported
difficulty moving his arms. At these times, he had diffuse
weakness with hypotonia and antigravity strength in all extremities. Deep tendon reflexes were absent, but vibration and
temperature sensation were normal. His gait was variably
ataxic with a stooped posture and a tendency to keep his mouth
open with tongue protruded. Further description of the gait is
provided in the legend to the videotape (see Video, Segment 1).
A polysomnogram revealed moderately reduced sleep efficiency with 50 awakenings, a slight increase in stage 1 sleep, a
normal rapid eye movement (REM) latency, and rapid eye
movements and atonia intruding into non-REM sleep. Mild to
moderate obstructive sleep apnea and periodic limb movements
of sleep were also present. The Multiple Sleep Latency Test
(MSLT) revealed an average sleep latency of 0.3 minutes and
sleep-onset REM periods in three of five naps. Genetic studies
indicated that he was positive for HLA DQB1*0602. Cerebrospinal fluid analyses revealed a mildly elevated protein and
undetectable levels of orexin/hypocretin. Based on these results, he was diagnosed with narcolepsy with cataplexy. He was
started on venlafaxine with subsequent resolution of his episodes of weakness (see Video, Segment 2).

Discussion
Recognition of a movement disorder as a conversion reaction
can help prevent unnecessary and potentially harmful testing
and therapeutic trials. On the other hand, significant harm can
result from the inaccurate diagnosis of a physical disorder as
psychogenic. Avoiding such an error can be difficult due to
overlapping features of psychogenic disorders and “organic”
movement disorders.1–3 Furthermore, psychogenic movements
can occur in the setting of a preexisting organic disorder,
further complicating the diagnosis.4 The patient presented here
had an unusual gait disorder associated with episodes of weakness and visual hallucinations. Several features were suggestive

839

of a psychogenic disorder, including the variable and staggering nature of the gait along with episodes of sudden buckling of
the knees without falls. The absence of objective abnormalities
on neurological examination (except for areflexia) and multiple
negative imaging and electrophysiological studies further
raised suspicion of a psychogenic disorder, resulting in psychiatric hospitalizations. His excessive daytime sleepiness was not
seriously evaluated during initial investigations. Once the diagnosis of narcolepsy with cataplexy was considered, appropriate diagnostic tests were performed and effective therapy
was initiated.
Although the patient also suffered from obstructive sleep
apnea, other findings indicated a diagnosis of narcolepsy with
cataplexy. He had excessive daytime sleepiness, episodes of
weakness with hypotonia, and an extremely short sleep latency
on the MSLT with three sleep-onset REM periods. The undetectably low levels of orexin/hypocretin in the cerebrospinal
fluid (CSF) also are supportive of this diagnosis.5–7 There is
considerable evidence that orexin/hypocretin promotes wakefulness,8 and the vast majority of patients with narcolepsy plus
cataplexy lack detectable orexin/hypocretin in the CSF.6
Although rare, cases of “status cataplecticus” have been
reported previously. Guilleminault and colleagues described a
patient with frequent attacks of complete cataplexy that they
referred to as “status cataplecticus.”9 Stahl and coworkers reported a patient with a brainstem glioblastoma presenting with
hundreds of partial cataplectic attacks each day, at a rate of one
every few seconds, associated with a peculiar variation of
posture and tone. This patient’s gait was described as resembling a puppet on strings with periods of a sagging face, limp
arms, and buckling knees. The authors referred to this continuous fluctuating partial cataplexy as “limp man syndrome.”10
As in the case presented here, the marked variations in muscle
strength and abnormal movements of the patient described by
Stahl and colleagues initially led to the incorrect diagnosis of a
psychogenic disorder. Additional patients have been reported
with status cataplecticus after initiating treatment with prazosin11 or after abrupt withdrawal of clomipramine.12 Thus, status
cataplecticus (limp man syndrome) should be considered in the
differential diagnosis of a psychogenic gait disorder, particularly in patients with excessive daytime sleepiness.

Legends to the Video
Segment 1. The patient before initiation of treatment. Ptosis, head drop, limp arms, and fluctuating dysarthria are apparent. Gait is variably wide-based with sudden staggering to
either side. There are moments of buckling at the knees without
falling.
Segment 2. The patient with normal speech and gait after
initiation of venlafaxine.
Acknowledgment: We thank the patient for generously allowing
presentation of the video accompanying this report.

References
1. Miyasaki JM, Sa DS, Galvez-Jimenez N, Lang AE. Psychogenic
movement disorders. Can J Neurol Sci 2003;30(Suppl. 1):S94 –
S100.
2. Hayes MW, Graham S, Heldorf P, de Moore G, Morris JGL. A
video review of the diagnosis of psychogenic gait: appendix and
commentary. Mov Disord 1999;14:914 –921.

Movement Disorders, Vol. 19, No. 7, 2004

840

CLINICAL/SCIENTIFIC NOTES

3. Lempert T, Brandt T, Dieterich M, Huppert D. How to identify
psychogenic disorders of stance and gait: a video study in 37
patients. Acta Neurol Scand 1991;82:335–340.
4. Ranawaya R, Riley D, Lang A. Psychogenic dyskinesias in patients with organic movement disorders. Mov Disord 1990;5:127–
133.
5. Nishino S, Ripley B, Overeem S, Lammers GJ, Mignot E. Hypocretin (orexin) deficiency in human narcolepsy. Lancet 2000;355:
39 – 40.
6. Mignot E, Lammers GJ, Ripley B, et al. The role of cerebrospinal
fluid hypocretin measurement in the diagnosis of narcolepsy and
other hypersomnias. Arch Neurol 2002;59:1553–1562.
7. Kanbayashi T, Inoue Y, Chiba S, et al. CSF hypocretin-1
(orexin-A) concentrations in narcolepsy with and without cataplexy and idiopathic hypersomnia. J Sleep Res 2002;11:91–93.
8. Scammell TE. The neurobiology, diagnosis, and treatment of narcolepsy. Ann Neurol 2003;53:154 –166.
9. Guilleminault C, Wilson RA, Dement WC. A study on cataplexy.
Arch Neurol 1974;31:255–261.
10. Sahl SM, Layzer RB, Aminoff MJ, Townsend JJ, Feldon S. Continuous cataplexy in a patient with a midbrain tumor: the limp man
syndrome. Neurology 1980;30:1115–1118.
11. Aldrich MS, Rogers AE. Exacerbation of human cataplexy by
prazosin. Sleep 1989;12:254 –256.
12. Martinez-Rodriguez J, Iranzo A, Santamaria J, et al. Status cataplecticus induced by abrupt withdrawal of clomipramine. Neurologia 2002;17:113–116.

Amphetamine-Induced Chorea in Attention
Deficit–Hyperactivity Disorder
John C. Morgan, MD, PhD,1* W. Christopher Winter, MD,2
and G. Frederick Wooten, MD2
1

Medical College of Georgia, Department of Neurology,
Augusta, Georgia, USA
2
University of Virginia, Department of Neurology,
Charlottesville, Virginia, USA

Abstract: Attention deficit– hyperactivity disorder (ADHD) is
treated frequently with stimulants in both children and adults.
While tics are occasional complications of stimulant therapy,
chorea is reported rarely. We describe an adult ADHD patient who developed chorea upon dose escalation of mixed
amphetamine salts, which resolved on discontinuation of the
drug. © 2004 Movement Disorder Society
Key words: ADHD; chorea; amphetamine
Attention deficit– hyperactivity disorder (ADHD) is commonly
diagnosed in children and may persist into adolescence and
adulthood in 40 to 60% of patients.1,2 Stimulants remain the
primary pharmacotherapy for ADHD in both children and

*Correspondence to: Dr. John C. Morgan, Medical College of Georgia, Department of Neurology, 1429 Harper Street, HF-1121A, Augusta, GA 30912. E-mail: jmorgan@mail.mcg.edu
Received 17 April 2003; Revised 8 September 2003; Accepted 16
December 2003
Published online 4 March 2004 in Wiley InterScience (www.
interscience.wiley.com). DOI: 10.1002/mds.20081

Movement Disorders, Vol. 19, No. 7, 2004

adults.3,4 Methylphenidate, pemoline, and amphetamine derivatives (frequently in extended-release preparations) are the
mainstays of therapy.4 Tics are the most common dyskinesia
reported in ADHD treatment with these drugs, although it
remains controversial as to how often stimulants “cause” a tic
disorder.5–9 There is perhaps more evidence that stimulants
may worsen a preexisting tic disorder, as reported with cocaine.10,11 Contrary to this line of thought, the Tourette’s Syndrome Study Group has demonstrated recently a decrease in tic
severity in children with tics and ADHD who were treated with
methylphenidate.9
While amphetamine-induced chorea has been reported in the
setting of acute12 or chronic abuse/addiction,5,13,14 it has been
reported only rarely in the setting of therapeutic uses for the
drug. In fact, a PubMed search of the English language literature yielded only one report of amphetamine-induced chorea in
the treatment of an adult: a woman taking an amphetamine
precursor for weight loss.15 We report on a man who developed
chorea temporally related to an increased dose of his ADHD
medication, mixed amphetamine salts (MAS).

Case Report
A 22-year-old man was diagnosed with ADHD at age 8. He
was treated with methylphenidate with adequate response for
14 years until 1 month before admission when he noted difficulty focusing and concentrating on his college class work. At
that time, he was switched from methylphenidate 20 mg t.i.d. to
MAS 20 mg b.i.d. He continued to have difficulty focusing on
tasks, and his dose was eventually escalated to 45 mg t.i.d. over
several weeks with improvement in his ADHD symptoms. Five
days after increasing his dose from 30 mg t.i.d. to 45 mg t.i.d.,
he awoke feeling nauseous. He was agitated, talking constantly,
and had adventitious movements of his face, trunk, and extremities noted by his roommate of which the patient was unaware.
There was no evidence of “punding” behavior, a behavior
where amphetamine users get “hung-up” repeating various
tasks for lengthy periods of time.16 He denied taking more
MAS than were prescribed and denied illicit drug use. He had
no prior history of tics, chorea, or other movement disorders.
He had no prior diagnosis of bipolar disorder, conversion
disorders, or malingering. There was no recent history of a
streptococcal infection, and he had never taken neuroleptics.
He had no history of connective tissue disease. He was also on
escitalopram (10 mg, stable dose) to treat anxiety and depression for 2 months before any changes in his ADHD medications. There was no family history of chorea or other movement
disorders.
On initial examination, he was afebrile with a pulse of 120
and normal blood pressure. He was alert and oriented and
talked constantly with normal content. His cranial nerve examination was normal. He had normal power with continuous
choreic movements of his upper and lower face, trunk, and all
extremities that were involuntary and not suppressible. He did
not manifest motor or vocal tics, and there was no evidence of
“punding” behavior. His movements ceased while sleeping.
Sensory examination, coordination, and reflexes were normal
except for evidence of a fine postural tremor in outstretched
arms.
Laboratory values demonstrated a normal complete blood
count and blood chemistries except for a slightly elevated
aspartate aminotransferase at 40 units/L (normal, 13–39 units/
L), elevated total bilirubin at 2.1 mg/dl (normal, 0.3–1.0 mg/

CLINICAL/SCIENTIFIC NOTES
dl), and an elevated creatine kinase at 780 units/L (normal,
55–170 units/L). Antinuclear antibody was negative. A urine
toxicology screen was positive for amphetamines (27,057
ng/mL confirmed by gas chromatography–mass spectrometry)
and negative for cocaine and other drugs of abuse. A head
computed tomography scan without contrast was normal.
Before our evaluation, he was treated initially with intravenous diphenhydramine (25 mg) for agitation and subsequently
with both intravenous lorazepam (3 mg) and diazepam (10 mg)
without improvement in his choreic movements. The MAS
were discontinued at presentation, and his chorea gradually
improved with only occasional truncal choreic movements
noted 2 days after admission. Three days after admission, his
movements had abated, although he remained agitated and
excessively talkative. He returned to his normal baseline mental
status within 4 days after stopping the drug and remained on
escitalopram as his chorea resolved. His aspartate aminotransferase, total bilirubin, and creatine kinase levels normalized
within 2 days after admission. The day after discharge, he was
reinitiated on methylphenidate at 40 mg t.i.d. with moderate
improvement in his ADHD symptoms and without recurrence
of chorea or other movement disorders.

Discussion
Prinzmetal and Bloomberg introduced amphetamines to treat
narcolepsy in 1935.17 Since that time, amphetamines have been
used extensively in the treatment of several other conditions,
including obesity18 and ADHD.3,4 Movement disorders induced by amphetamines are extremely rare in these therapeutic
settings, despite considerable exposure to numerically significant patient populations. In fact, a National Library of Medicine (PubMed) search identified only one report of amphetamine-induced chorea when an amphetamine precursor
(clobenzorex) was used as an anorectic.15
Our patient’s history is compelling for an association of his
chorea with the escalation of his MAS dose since he was on a
stable daily dose of escitalopram for 2 months. Mattson and
Calverley reported an 8-year-old boy with a learning disability
who had worsening of preexisting choreoathetosis in the upper
extremities when he was treated with 5 mg of dextroamphetamine for hyperactivity.19 This choreoathetosis recurred on
rechallenge at the same dose and immediately resolved when
the patient was treated with 25 mg of diphenhydramine.19
Mattson and Calverley also reported a 3-year-old girl with a
history of focal-onset seizures who developed choreoathetosis
of the arms and legs after ingesting 5 mg of methylphenidate
for treatment of drowsiness related to antiepileptic therapy with
phenobarbital, phenytoin, and mephobarbital.19 She then developed choreoathetosis in the same distribution when treated with
2.5 mg of dextroamphetamine 1 week later, resolving within 12
hours.19
Unlike the 3-year-old girl reported by Mattson and Calverley,19 our patient had never developed chorea on high doses of
methylphenidate (up to 40 mg t.i.d.), but did develop chorea
when taking high doses of MAS. His total daily dose of MAS
(135 mg) when he developed chorea was 2.5 times the average
effective daily dose (54 mg) of MAS in a randomized, placebocontrolled trial in adult ADHD patients.1 Perhaps chronic therapy with methylphenidate made him physiologically less sensitive to amphetamines because methylphenidate acts similarly
to amphetamines in the central nervous system, facilitating
presynaptic dopamine release in the striatum20 and blocking

841

re-uptake of dopamine by the dopamine transporter.21 While
some authors have reported that tolerance to methylphenidate
occurs in humans (especially at doses higher than 60 mg per
day),22,23 others believe that neither tolerance nor sensitization
to methylphenidate occurs to a significant degree in the treatment of ADHD.24
While hyperdopaminergic states are classically associated
with chorea,20,25,26 another possibility is that serotonergic modulation of dopaminergic systems may have influenced the development of chorea in our patient. Certainly, chorea has been
reported in patients taking other selective serotonin-reuptake
inhibitors (SSRIs): paroxetine27 and fluoxetine.28,29 Additionally, amphetamines not only promote presynaptic release of
dopamine, they also promote presynaptic release of serotonin30
unlike methylphenidate.31 In rats, serotonin also appears necessary to promote the markedly increased firing rate of neostriatal neurons induced by high doses of dextroamphetamine
(7.5 mg/kg).32 Our patient would be at risk for a hyperserotonergic state due to high-dose amphetamine treatment in association with his concomitant use of escitalopram (the biologically
active (S) enantiomer of the SSRI citalopram).
While citalopram reduces extracellular striatal dopamine
concentrations and increases [11C]raclopride binding to D2
receptors in some animal models,33 there are multiple lines of
evidence that citalopram and elevated brain serotonin levels are
associated with enhanced striatal dopaminergic responses. In
humans, citalopram appears to decrease [11C]raclopride binding in the striatum, possibly indicating increased dopamine
release in the setting of elevated serotonin levels.34 Chronic
administration of citalopram results in increased amphetamineinduced locomotor activity in rats.35 Other studies have shown
that citalopram increases D2 receptor expression in rat striatum
at the receptor and mRNA levels.36 These studies suggest that
escitalopram, either directly or indirectly (through its SSRI
action or by altering expression of dopamine receptors), could
have influenced the manifestation of our patient’s chorea in the
setting of high-dose MAS treatment. While the exact mechanism of amphetamine-induced chorea is unknown, we recommend caution when prescribing high-dose amphetamine treatment for ADHD patients taking concomitant SSRI therapy.

References
1. Spencer T, Biederman J, Wilens T, et al. Efficacy of a mixed
amphetamine salts compound in adults with attention-deficit/hyperactivity disorder. Arch Gen Psychiatry 2001;58:775–782.
2. Barkley RA. Major life activity and health outcomes associated
with attention-deficit/hyperactivity disorder. J Clin Psychiatry
2002;63(Suppl. 12):10 –15.
3. Adler LA, Chua HC. Management of ADHD in adults. J Clin
Psychiatry 2002;63(Suppl. 12):29 –35.
4. Wilens TE, Spencer TJ, Biederman J. A review of the pharmacotherapy of adults with attention deficit/hyperactivity disorder. J
Atten Disord 2002;5:189 –202.
5. Weiner WJ, Sanchez-Ramos J. Movement disorders and dopaminomimetic stimulant drugs. In: Lang AE, Weiner WJ, editors.
Drug-induced movement disorders. Mt. Kisco, New York: Futura
Publishing Co., Inc; 1992. p 315–337.
6. Lipkin PH, Goldstein IJ, Adesman AR. Tics and dyskinesias
associated with stimulant treatment in attention-deficit hyperactivity disorder. Arch Pediatr Adolesc Med 1994;148:859 – 861.
7. Efron D, Jarman F, Barker M. Side effects of methylphenidate and
dexamphetamine in children with attention deficit hyperactivity
disorder: a double-blind, crossover trial. Pediatrics 1997;100:662–
666.

Movement Disorders, Vol. 19, No. 7, 2004

842

CLINICAL/SCIENTIFIC NOTES

8. Varley CK, Vincent J, Varley P, Calderon R. Emergence of tics in
children with attention deficit hyperactivity disorder treated with
stimulant medications. Compr Psychiatry 2001;42:228 –233.
9. Tourette’s Syndrome Study Group. Treatment of ADHD in children with tics. Neurology 2002;58:527–536.
10. Pascual-Leone A, Dhuna A. Cocaine-associated multifocal tics.
Neurology 1990;40:999 –1000.
11. Cardoso FE, Jankovic J. Cocaine-related movement disorders.
Mov Disord 1993;8:175–178.
12. Rhee KJ, Albertson TE, Douglas JC. Choreoathetoid disorder
associated with amphetamine-like drugs. Am J Emerg Med 1988;
6:131–133.
13. Lundh H, Tunving K. An extrapyramidal choreiform syndrome
caused by amphetamine addiction. J Neurol Neurosurg Psychiatry
1981;44:728 –730.
14. Bartzokis G, Beckson M, Wirshing DA, et al. Choreoathetoid
movements in cocaine dependence. Biol Psychiatry
1999;45:1630 –1635.
15. Leys D, Destee A, Petit H, Warot P. Chorea associated with oral
contraception. J Neurol 1987;235:46 – 48.
16. Rylander G. Psychoses and the punding and choreiform syndromes
in addiction to central stimulant drugs. Psychiatr Neurol Neurochir
1972;75:203–212.
17. Prinzmetal M, Bloomberg W. The use of benzedrine for the treatment of narcolepsy. JAMA 1935;105:2051–2054.
18. Bray GA. Use and abuse of appetite-suppressant drugs in the
treatment of obesity. Ann Intern Med 1993;119:707–713.
19. Mattson RH, Calverley JR. Dextroamphetamine-sulfate induced
dyskinesias. JAMA 1968;204:108 –110.
20. Weiner WJ, Nausieda PA, Klawans HL. Methylphenidate-induced
chorea: case report and pharmacologic implications. Neurology
1978;28:1041–1044.
21. Seeman P, Madras B. Methylphenidate elevates resting dopamine
which lowers the impulse-triggered release of dopamine: a hypothesis. Behav Brain Res 2002;130:79 – 83.
22. Winsberg B, Matinsky S, Kupietz S, Richardson E. Is there dosedependent tolerance associated with chronic methylphenidate therapy in hyperactive children? Oral dose and plasma considerations.
Psychopharmacol Bull 1987;23:107–110.
23. Ross DC, Fischhoff J, Davenport B. Treatment of ADHD when
tolerance to methylphenidate develops. Psychiatr Serv 2002;53:
102.
24. Solanto MV. Clinical psychopharmacology of AD/HD: implications for animal models. Neurosci Biobehav Rev 2000;24:27–30.
25. Klawans HL, Weiner WJ. The effect of d-amphetamine on choreiform movement disorders. Neurology 1974;24:312–318.
26. Nausieda PA, Bieliauskas LA, Bacon LD, et al. Chronic dopaminergic sensitivity after Sydenham’s chorea. Neurology 1983;33:
750 –754.
27. Fox GC, Ebeid S, Vincenti G. Paroxetine-induced chorea. Br J
Psychiatry 1997;170:193–194.
28. Bharucha KJ, Sethi KD. Complex movement disorders induced by
fluoxetine. Complex movement disorders induced by fluoxetine.
Mov Disord 1996;11:324 –326.
29. Nielsen AS, Mors O. Choreiform dyskinesias with acute onset and
protracted course following fluoxetine treatment. J Clin Psychiatry
1999;60:868 – 869.
30. Bradbury AJ, Costall B, Naylor RJ, Onaivi ES. 5-Hydroxytryptamine involvement in the locomotor activity suppressant effects of
amphetamine in the mouse. Psychopharmacology (Berl) 1987;93:
457– 465.
31. Kuczenski R, Segal DS. Effects of methylphenidate on extracellular dopamine, serotonin, and norepinephrine: comparison with
amphetamine. J Neurochem 1997;68:2032–2037.
32. Rebec GV, Alloway KD, Curtis SD. Apparent serotonergic modulation of the dose-dependent biphasic response of neostriatal
neurons produced by d-amphetamine. Brain Res 1981;210:277–
289.

Movement Disorders, Vol. 19, No. 7, 2004

33. Dewey SL, Smith GS, Logan J, et al. Serotonergic modulation of
striatal dopamine measured with positron emission tomography
(PET) and in vivo microdialysis. J Neurosci 1995;15:821– 829.
34. Tiihonen J, Kuoppamaki M, Nagren K, et al. Serotonergic modulation of striatal D2 dopamine receptor binding in humans measured with positron emission tomography. Psychopharmacology
(Berl) 1996;126:277–280.
35. Arnt J, Overo KF, Hyttel J, Olsen R. Changes in rat dopamine- and
serotonin function in vivo after prolonged administration of the
specific 5-HT uptake inhibitor, citalopram. Psychopharmacology
(Berl) 1984;84:457– 465.
36. Kameda K, Kusumi I, Suzuli K, et al. Effects of citalopram on
dopamine D2 receptor expression in the rat brain striatum. J Mol
Neurosci 2000;14:77– 86.

Unusual Forehead Tremor in a Patient With
Essential Tremor
Panida Piboolnurak, MD,1 Seth L. Pullman, MD,1
and Elan D. Louis, MD, MS1–3*
1
Department of Neurology, College of Physicians and
Surgeons, Columbia University, New York, New York, USA
2
Gertrude H. Sergievsky Center, College of Physicians and
Surgeons, Columbia University, New York, New York, USA
3
Taub Institute for Research on Alzheimer’s Disease and the
Aging Brain, College of Physicians and Surgeons, Columbia
University, New York, New York, USA

Abstract: Voice and head (neck) tremor commonly occur in
patients with essential tremor (ET), but involvement of cranial
musculature is generally limited to these specific cranial structures, and action tremor of the forehead has not been reported.
We describe a patient with ET who had forehead tremor. The
tremor seemed to be task-specific, and neurophysiological features suggested that the forehead tremor was dystonic. The
presence of forehead tremor in a patient with ET probably
indicates an additional pathophysiologic process. The explanation for the specificity of involvement of cranial musculature in
ET is not known, but this clinical observation might help guide
investigators who are interested in the underlying pathophysiology of this condition. © 2004 Movement Disorder Society
Key words: essential tremor; dystonia; clinical heterogeneity; neurophysiology; pathophysiology
Patients with essential tremor (ET) typically have kinetic
tremor. The tremor is most commonly seen in the arms, but it
can involve other parts of the body, including the head.1,2

This article includes Supplementary Video, available online at http://
www.interscience.wiley.com/jpages/0885-3185/suppmat
*Correspondence to: Dr. Elan D. Louis, Unit 198, Neurological
Institute, 710 West 168th Street, New York, NY 10032.
E-mail: EDL2@columbia.edu
Received 11 November 2003; Accepted 22 December 2003
Published online 16 March 2004 in Wiley InterScience (www.
interscience.wiley.com). DOI: 10.1002/mds.20080

CLINICAL/SCIENTIFIC NOTES
Facial tremor, however, appears to be uncommon, and to our
knowledge, it has not been reported. We present an ET patient
with forehead tremor; however, clinical and neurophysiological
features suggested that another process in addition to ET was
the cause of the forehead tremor.

Case Report
Our patient is a 62-year-old, right-handed man whose tremor
began at age 44 years with an action tremor of both arms,
particularly on the right. Initially, the tremor was apparent
during different activities (e.g., writing, eating, drinking) and
gradually worsened so that he occasionally began to use his left
hand for writing and pouring. He was given a diagnosis of ET
by his family doctor, but no treatment was prescribed. By age
52 years, family members pointed out a head tremor, which
was mild and did not bother the patient. At age 62 years, he was
first seen by one of the authors (E.D.L.) at the Center for
Parkinson’s Disease and Other Movement Disorders at Columbia Presbyterian Medical Center. His main complaint was
worsening arm tremor, for which he wanted treatment. He also
noted a head (neck) tremor, although it was not bothersome. He
did not notice forehead tremor. His medications were atenolol
50 mg per day for hypertension and clonazepam 0.25 mg twice
a day for anxiety. He noted that ethanol (one glass of wine) had
a mild beneficial effect on his tremor. His past medical history
was unremarkable. His mother had died at age 72 years and had
had head (neck) tremor for approximately 10 years. He had no
siblings and his two children, aged 29 and 35 years, do not have
tremor. His arm tremor was rated on examination with the
Washington Heights–Inwood Genetic Study of Essential
Tremor (WHIGET) Rating Scale3 (0 ⫽ no visible tremor; 1 ⫽
low-amplitude or intermittent tremor; 2 ⫽ moderate-amplitude
tremor that is clearly oscillatory and usually present; 3 ⫽
high-amplitude tremor). The examination revealed a mild regular postural tremor of both arms (rating ⫽ 1) without dystonic
posturing of the limbs, a moderate kinetic tremor of the right
arm (rating ⫽ 2) and mild to moderate kinetic tremor of the left
arm (rating ⫽ 1-2; see Video, Segments 1–3). Kinetic tremor
was tested while pouring, drinking, using a spoon, touching
finger-to-nose, and drawing spirals (see Video, Segments 2 and
3). There was no rest tremor. He had a mild head tremor but no
voice tremor. There was no dystonic neck deviation. When he
was sitting quietly and facing the examiner, there was no
forehead tremor (see Video, Segment 4). While speaking, his
frontalis muscles contracted, resulting in bilateral eyebrow
elevation and forehead tremor (see Video, Segment 5). When
he stopped speaking, the tremor stopped. When he was asked to
speak while trying not to raise his eyebrows, there was no
forehead tremor. When he raised his eyebrows without speaking, there was minimal and intermittent forehead tremor. His
examination was otherwise normal. His gait and balance were
normal. He was able to tandem walk without difficulty. He had
no weakness, cranial nerve abnormalities, upper motor neuron
signs, cerebellar signs, parkinsonism, or sensory impairment.
His comprehensive metabolic panel and thyroid function tests
were normal. To further evaluate his atypical forehead tremor,
he was referred for a computerized tremor analysis test.

Neurophysiological Findings
Four channels were used to record frontalis and orbicularis
muscles bilaterally with silver/silver chloride electromyogra-

843

phy (EMG) surface electrodes (Fig. 1). One channel recorded
accelerometry using ultra-light piezoresistive tri-axial miniature accelerometers (⫾ 25 g, weight: 1.2 g) with linear sensitivities of approximately 4.5 mV/g in the physiologic range,
attached rostral to the left eyebrow. Data were acquired and
analyzed using semiautomatic interactive software developed
in the Clinical Motor Physiology Laboratory during the following tasks: sitting, reading quietly, reading out loud, talking,
counting, finger-to-nose movement, pouring water, and writing.
When seated and silent, there was no tremor of the forehead.
When he was reading out loud, talking, or counting, there was
a 1 to 3 Hz co-contraction of the frontalis and orbicularis oculi
muscles, associated with forehead tremor. The tremor was
irregular and associated with a mix of short duration (50 –100
msec) and longer duration (200 – 800 msec) EMG bursts. EMG
activities of bilateral frontalis and orbicularis oculi muscles
were not always synchronous. No forehead tremor was present
during motor tasks of the hands such as finger-to-nose movement, pouring water, or writing.

Discussion
Tremor is defined by an oscillatory movement of a body part,
produced by rhythmic alternating or simultaneous contractions
of antagonistic muscle groups. It is generally described by the
affected sites, activating conditions, amplitude, frequency, regularity, and rhythmicity. Because tremors of different causes
have their own characteristics, these differences can often aid in
the differential diagnosis.
In patients with ET, facial tremor is uncommon. In a series
of 350 patients with ET seen at a tertiary referral clinic, sites of
tremor included the hand (89.7%), head (40.9%), voice
(17.7%), legs (13.7%), jaw (7.1%), face (2.9%), trunk (1.7%),
and tongue (1.4%).4 To our knowledge, forehead tremor has
not been reported in patients with ET. Critchley, in a review
article on ET, commented that tremor of the head and neck may
occur at the occipitoatlantic articulation, in the masseters, facial
muscles, eyelids, external ocular muscles, extrinsic and intrinsic laryngeal muscles, tongue, and palate,2 but they did not
comment on the forehead. In most clinical series, the presence
of forehead tremor is not specifically commented upon.5–7 In a
population-based study of 175 ET cases in Papua New Guinea,1
the authors specifically reported that muscles of the upper face
(frontalis and periorbital muscles) were not involved in any
cases.
It can be difficult on general neurological examination to
distinguish dystonic tremor from the action tremor of ET.
Moreover, there are many reports of the coexistence of ET and
dystonia in the same patient.8 –14 Our patient’s forehead tremor
seemed to be task-specific, which suggested that it was dystonic. Furthermore, physiologically, the combination of irregular tremor, low tremor frequency, and co-contraction of antagonistic muscle groups with mixed short and long duration
EMG bursts suggested that the forehead tremor was dystonic.
In summary, although voice and head (neck) tremor commonly occur in patients with ET, involvement of cranial musculature is generally limited to these specific cranial structures
and action tremor of the forehead has not been reported. The
presence of forehead tremor probably indicates an additional
pathophysiologic process, and objective computerized physiologic testing may aid in the differential diagnosis. The explanation for the specificity of involvement of cranial musculature
in ET is not known but this clinical observation might help

Movement Disorders, Vol. 19, No. 7, 2004

844

CLINICAL/SCIENTIFIC NOTES

FIG. 1. Upper four traces show surface electromyogram (EMG) obtained from bilateral frontalis and orbicularis oculi muscles while the patient was
speaking and experiencing forehead tremor. Note the irregularly timed short and long burst durations (50 – 800 msec) in all muscles. Note also the
co-contractions of the antagonistic frontalis and orbicularis muscles. The bottom trace shows the corresponding irregular left forehead movements
recorded rostral to the left eyebrow.

guide investigators who are interested in the underlying pathophysiology of this condition.
Acknowledgments: This study was funded by the National Institutes of Health (R01 NS42859, R01 NS39422, P30 ES09089, and
RR00645 to E.D.L.).

Legends to the Video
Segment 1. The patient has mild postural tremor of both
arms.
Segment 2. The patient is pouring water from one cup to
another and using a spoon to bring water to his mouth. There is
moderate kinetic tremor in the right arm and mild to moderate
kinetic tremor in the left arm.
Segment 3. While he is performing the finger to nose maneuver, the patient has moderate kinetic tremor in the right arm
and mild to moderate kinetic tremor in the left arm. No forehead tremor is visible.
Segment 4. When he is sitting quietly, there is no forehead
tremor.
Segment 5. The patient is asked to speak. His frontalis
muscles contract, resulting in elevation of the eyebrows and
forehead tremor.

References
1. Hornabrook RW, Nagurney JT. Essential tremor in Papua, New
Guinea. Brain 1976;99:659 – 672.
2. Critchley M. Observations on essential (heredofamilial) tremor.
Brain 1949;72(Pt 2):113–139.

Movement Disorders, Vol. 19, No. 7, 2004

3. Louis ED, Barnes L, Wendt KJ, Ford B, et al. A teaching videotape
for the assessment of essential tremor. Mov Disord 2001;16:89 –
93.
4. Lou JS, Jankovic J. Essential tremor: clinical correlates in 350
patients. Neurology 1991;41(Pt 1):234 –238.
5. Massey EW, Paulson GW. Essential vocal tremor: clinical characteristics and response to therapy. South Med J 1985;78:316 –317.
6. Findley LJ, Gresty MA. Head, facial, and voice tremor. Adv
Neurol 1988;49:239 –253.
7. Longe AC. Essential tremor in Nigerians: a prospective study of 35
cases. East Afr Med J 1985;62:672– 676.
8. Couch JR. The relationship between spasmodic torticollis and
essential tremor. Trans Am Neurol Assoc 1975;100:181–183.
9. Deuschl G, Heinen F, Guschlbauer B, Schneider S, Glocker FX,
Lucking CH. Hand tremor in patients with spasmodic torticollis.
Mov Disord 1997;12:547–552.
10. Dubinsky RM, Gray CS, Koller WC. Essential tremor and dystonia. Neurology 1993;43:2382–2384.
11. Durr A, Stevanin G, Jedynak CP, Penet C, Agid Y, Brice A.
Familial essential tremor and idiopathic torsion dystonia are different genetic entities. Neurology 1993;43:2212–2214.
12. Ferraz HB, De Andrade LA, Silva SM, Borges V, Rocha MS.
[Postural tremor and dystonia. Clinical aspects and physiopathological considerations]. Arq Neuropsiquiatr 1994;52:466 – 470.
13. Koller WC, Busenbark K, Miner K. The relationship of essential
tremor to other movement disorders: report on 678 patients. Essential Tremor Study Group. Ann Neurol 1994;35:717–723.
14. Munchau A, Schrag A, Chuang C, et al. Arm tremor in cervical
dystonia differs from essential tremor and can be classified by
onset age and spread of symptoms. Brain 2001;124(Pt 9):1765–
1776.

CLINICAL/SCIENTIFIC NOTES

Refined Linkage to the RDP/DYT12 Locus on
19q13.2 and Evaluation of GRIK5 as a
Candidate Gene
Christoph Kamm, MD,1 Joanne Leung, MS,1
Soni Joseph, BS,2 William B. Dobyns, MD,3
Alison Brashear, MD,4 Xandra O. Breakefield, PhD,1
and Laurie J. Ozelius, PhD2*
1

Molecular Neurogenetics Unit, Departments of Neurology
and Radiology and Neuroscience Program, Massachusetts
General Hospital and Harvard Medical School, Boston,
Massachusetts, USA
2
Department of Molecular Genetics, Albert Einstein College
of Medicine, Bronx, New York, USA
3
Department of Human Genetics, Neurology and Pediatrics,
University of Chicago, Illinois, USA
4
Department of Neurology, Indiana University School of
Medicine, Indianapolis, Indiana, USA
Abstract: By examining two previously described families
with rapid-onset dystonia parkinsonism, we have identified a
key recombination event that places the disease locus (DYT12)
into a 5.9 cM interval flanked by markers D19S224 and
D19S900. Evaluation of a positional candidate gene, the glutamate receptor subunit GRIK5, revealed no mutations. © 2004
Movement Disorder Society
Key words: DYT12; rapid-onset dystonia–parkinsonism;
kainate receptor
Rapid-onset dystonia–parkinsonism (RDP) is a rare, autosomaldominantly inherited, disabling movement disorder. Typically,
patients experience sudden onset over hours to days of dystonic
posturing of the limbs, bradykinesia, postural instability, dysarthria, and dysphagia, followed by little or no progression.1 Age of
onset ranges from late childhood to early adulthood and may be
triggered by stressful events, including physical exercise, emotional stress, fever, or childbirth. Linkage of this disease gene to an
8 cM region on chromosome 19q13, defined by flanking markers
D19S587 and D19S900, has been reported.2 In an attempt to
reduce the minimal chromosomal region containing the disease
gene, we genotyped 13 known polymorphic markers in the
DYT12 region in 2 unrelated, previously described RDP families,
RDP-13 and RDP-2.4 Both of these families show linkage to the
candidate region on chromosome 19q13, with the highest com-

Dr. Kamm’s present address is Department of Neurodegenerative
Diseases and Hertie-Institute for Clinical Brain Research, University of
Tuebingen, Germany
*Correspondence to: Laurie J. Ozelius, Department of Molecular Genetics, Albert Einstein College of Medicine, Ullmann 1211,
1300 Morris Park Avenue, Bronx, NY 10461.
E-mail: ozelius@aecom.yu.edu
Received 20 August 2003; Revised 18 December 2003; Accepted 29
December 2003
Published online 16 March 2004 in Wiley InterScience (www.
interscience.wiley.com). DOI: 10.1002/mds.20095

845

bined two-point logarithm of odds score occurring at D19S198
(Z ⫽ 4.04 at ␪ ⫽ 0.0).2
One of the candidate genes in this region, GRIK5, encodes a
kainate-type glutamate receptor subunit, KA2. In rat brain,
abundant GRIK5 mRNA levels have been found in the basal
ganglia, especially in the striatum, substantia nigra pars compacta, and subthalamic nucleus,5 regions that are critically
involved in movement control.6 Given that corticostriatal glutamatergic neurons form the major afferent projection to the
striatum, the KA2 subunit could act by modulating dopaminergic input into the striatum. To evaluate the role of the GRIK5
gene in RDP, we screened two representative affected individuals from both of the RDP families for mutations in the coding
region (exons 1– 19) and one putative regulatory region.7,8

Patients and Methods
Blood samples were collected from participants after obtaining
informed consent, and DNA was extracted using standard procedures. Two representative affected individuals from each family,
RDP-1 and RDP-2 (both Caucasian), containing the complete
haplotypes across the region were used for mutational analysis
along with 3 control subjects from the same ethnic group: Patients
III-9 and II-4 from Family RDP-1 and patients II-2 and II-4 from
Family RDP-2 [pedigree designations according to Kramer and
colleagues2]. The structure, clinical features, and marker haplotypes of these 2 RDP families have been described in detail
elsewhere3,4; briefly, there were 12 affected members in Family
RDP-1 and 4 affected members in Family RDP-2.
The exon–intron structure for the human GRIK5 gene can be
found under GenBank accession no. NT_011109 (LocusLink
2901, UniGene Cluster Hs.249141).The genomic sequence of the
human GRIK5 gene was used to design primer sets (see Table 1)
to amplify fragments, spanning the entire coding region, splice
junctions, and a putative regulatory region (778 bp) within the 5⬘
untranslated region (UTR) of the human GRIK5 gene.
The entire coding sequence of the human GRIK5 gene was
amplified from genomic DNA of 4 patients and 3 controls by
polymerase chain reaction (PCR). Fragments of less than 350 bp
were first screened for mutations using single-stranded conformation polymorphism (SSCP) analysis, followed by direct sequencing (see below). Variants seen on the SSCP gel were sequenced
and compared to control samples. Fragments larger than 350 bp
were sequenced directly without SSCP analysis. PCR products
were sequenced using either the Thermo Sequenase radiolabeled
terminator cycle sequencing kit (USB) or the Taq DyeDeoxy
Terminator cycle sequencing kit (Applied Biosystems), and run on
an ABI 3700 PRISM automated sequencer.
Genotyping was performed according to a standard PCR protocol (Research Genetics/Invitrogen) using an ABI 377 automated
DNA sequencer. The Genescan and Genotyper software package
from ABI was used to determine fragment sizes and to assign
allele status. We used the following microsatellite markers on
chromosome 19q13 spanning the DYT12 locus: D19S587 (59.36
cM), D19S224 (61.49), D19S570 (62.03), D19S220 (62.03),
D19S422 (63.10), D19S417 (63.10), D19S200 (63.63), D19S223
(64.16), D19S400 (64.70), D19S198 (65.77), D19S420 (66.30),
D19S408 (67.37), and D19S900 (67.37). Sex-averaged map positions in centimorgans (obtained online at http://research.marshfieldclinic.org/genetics/) are given in parentheses.

Movement Disorders, Vol. 19, No. 7, 2004

846

CLINICAL/SCIENTIFIC NOTES
TABLE 1. Primers used to amplify GRIK5 fragments and PCR conditions

Exon

Forward primer (5⬘33⬘)

Reverse primer (5⬘33⬘)

5⬘UTR
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19

CCCCCTTTTACTGCTCTG
CCACATAGTAATCTCCCCTTG
CTCCTTCCTCAGGACTCAG
TTGCCAGTGTCTGATCCTC
AGAAGCAGGATGGAGGCCA
CATGCCTGGGTACCCAGAAG
CCTGTGGGTCTCTGTCTCTCA
AGGCCTCACCACCTCTTC
AGGCAGCCTCTTATCCATCC
TGCCTTTCTCTGTGGATGTC
TGCCATGACCTCAGGCAG
CGCAACCCAGCCACTAGA
AGGCCCTGAGCCTCCATG
TCCCAGTAGGCAGTGGAC
GGCAGAGGCAGATAGAAAG
ACGCCTGAGAGGTTCTGG
GCCCTGCTGTGTTCCACAC
GGGAAGGGGACACCATAC
CCCAATGCCACAATCTTCAC
AGCCTCCAGCCCTTCCTC

TCACCCATGCGCAGTGATGAG
TCACCCATGCGCAGTGATGAG
CTCACTGGTGTCCGTGGTC
CTCCATCCTGCTTCTCCGC
TCACACTCAGCCTTGGCGC
TCACCTTACGGAGGATGAG
TGGGGCTAAGCCCTAATGGGA
TGTGCAGAGTGTTTCTGG
ACCATGCGCAGGTAGTTC
CAGGTGCGGTTAGAGTAC
TGCATCCCTCCACCTCAC
CTGCTTCTGAGGTTCGACTG
CTCCGTGCATTTCTCTCTAAC
GGTGTCTCCGGGTCTCAC
ACACGCTGCACGTCTCTC
ACTCCAGCCCGTGACTCAC
CCTGGGTTGAGGGAGACTTC
GGCACAGTTTGGGGTTTG
ACAGCCCCAACTCCCTTTG
TGCCGAAGCCCACTGCTA

Product
size (bp)

PCR ann.
temp. (°C)

778
185
220
285
207
234
178
233
199
344
239
350
239
164
223
227
339
233
242
526

55°
60°
60°
55°
62°
60°
62°
66°
62°
57°
66°
66°
60°
60°
60°
69°
60°
60°
55°
69°

PCR, polymerase chain reaction; ann. temp., annealing temperature; UTR, untranslated region.

Results
Linkage was evaluated to 13 known polymorphic markers
within the DYT12 region as described in Kramer and coworkers.2
Families RDP-1 and RDP-2 do not share a common haplotype in
this region.2 In Family RDP-1, a key recombination event between
marker D19S224 and the putative disease gene refined the candidate region to a 5.9 cM interval between this marker and D19S900
(Fig. 1, III.6). Several markers were generated between D19S224
and D19S220 in an attempt to further define the proximal crossover; however, all four markers tested were uninformative (data
not shown). Further refinement of the distal recombination was not
attempted, as marker D19S408 (according to http://www.
genome.ucsc.edu/cgi-bin/hgGateway) is located within 120 kb of
D19S900, but does not recombine (Fig. 1, III.16).
A 500-bp fragment within the 3⬘ end of intron 1 of the rat
GRIK5 gene (exon 1 in rat is untranslated) has been identified
as acting as a transcriptional silencer7 by binding to the nuclear
orphan receptors COUP-TF1, EAR2, and NURR1.8 Alignment
of the nucleotide sequence between rat and human genomic
GRIK5 sequences revealed significant sequence homology
(86% identity over a 255-bp region within this 500-bp fragment) between the two species; therefore, we included this
untranslated region in our screen for mutations in RDP patients.
Genomic DNA from 2 affected members from each family
(RDP-1 and RDP-2) was used to amplify all GRIK5 exons that
contain coding sequence, as well as a putative regulatory fragment within the human 5⬘ UTR using the flanking intronic
primers listed in Table 1. Amplified fragments of appropriate
length (⬍350 bp) were screened by SSCP. When no mutations
were identified, all fragments from these individuals were sequenced; this screen did not reveal any changes in nucleotide
sequence compared to 3 healthy Caucasian controls.

Discussion
We report further genetic studies in two previously described
families with RDP with linkage to the DYT12 locus. By ob-

Movement Disorders, Vol. 19, No. 7, 2004

serving a key recombination in Family RDP-1, we were able to
refine the DYT12 candidate region to a 5.9 cM interval between
the microsatellite markers D19S224 and D19S900. This relatively large region, which does not overlap with a novel locus
for late-onset Parkinson’s disease on chromosome 19p13.3-q12
recently reported in a large Cuban family,9 contains many
genes, approximately 230 (according to http://www.ncbi.nlm.
nih.gov). In addition to RDP-1, there are 2 other published RDP
families, but neither Family RDP-21 (this study) or an Irish
family, RDP-310 (Andrew Green, personal communication),
show recombination events that would further refine the locus,
so we decided to focus on positional candidates. Among these
genes, GRIK5 appeared to be a particularly attractive candidate,
because it encodes an ion channel that is preferentially expressed in the basal ganglia. However, no mutations or polymorphisms in the coding region, splice junctions, or a putative
regulatory region were found in 2 patients each from 2 RDP
families. Thus, RDP in these 2 families is unlikely to be caused
by mutations in GRIK5, although our analysis does not exclude
gene rearrangements, large deletions, or mutations in other
promoter or regulatory regions. Among the many genes in the
region, a few that are expressed in the central nervous system
and may be candidates for RDP include the Ryanodine receptor
(RYR1), glia maturation factor, gamma (GMF-g), delta-like 3
(DLL3), Periaxin (PRX), D4, numb homolog (Drosophila)-like
(NUMBL), and suppressor of Ty 5 homolog (SUPT5H). Information about genes and positions can be found online at LocusLink (http://www.ncbi.mlm.nih.gov).
Given the large candidate region, future efforts that aim to
better define the region harbouring the disease gene will be
critical to the eventual identification of the gene causing RDP.
To that end, more families with the typical RDP phenotype
need to be identified and, potentially, other molecular techniques, such as microarray analysis using positional candidates,
should be applied. The eventual identification of the gene
responsible for RDP is likely to reveal insights into molecular
pathways common to both dystonia and parkinsonism.

CLINICAL/SCIENTIFIC NOTES

847

FIG. 1. Partial pedigree for Family RDP-1 showing recombination events. Haplotypes of informative markers are shown for critical family members
of RDP-1. Marker order is given at the left of the figure, with genetic distances in centimorgans (cM) (according to http://research.marshfieldclinic.org/
genetics/). Shaded individuals are affected, the haplotype of the disease-bearing chromosome is boxed and shaded, and an asterisk indicates
cross-overs. Recombination events in individual III.6 (proximal) and III.16 (distal) place the DYT12 locus between markers D19S224 and D19S900
in a 5.9 cM interval. The pedigree has been anonymised to protect the identity of the family. RDP, rapid-onset dystonia–parkinsonism.

Acknowledgments: We thank all patients and family members who
participated in this study. This study was supported in part by a
research grant from the Dystonia Medical Research Foundation
(DMRF; L.O.) and the National Institute of Neurological Disease and
Stroke MGH/MIT Parkinson’s Disease Center (NS38372 to X.O.B.).
C.K. was a fellow of the Deutsche Forschungsgemeinschaft (DFG).

References
1. Brashear A, Butler IJ, Ozelius LJ, et al. Rapid-onset dystonia–
parkinsonism: a report of clinical, biochemical, and genetic studies
in two families. Adv Neurol 1998;78:335–339.
2. Kramer PL, Mineta M, Klein C, et al. Rapid-onset dystonia–
parkinsonism: linkage to chromosome 19q13. Ann Neurol 1999;
46:176 –182.
3. Dobyns WB, Ozelius LJ, Kramer PL, et al. Rapid-onset dystonia–
parkinsonism. Neurology 1993;43:2596 –2602.
4. Brashear A, DeLeon D, Bressman SB, Thyagarajan D, Farlow MR,
Dobyns WB. Rapid-onset dystonia–parkinsonism in a second family. Neurology 1997;48:1066 –1069.
5. Wullner U, Standaert DG, Testa CM, Penney JB, Young AB.
Differential expression of kainate receptors in the basal ganglia of
the developing and adult rat brain. Brain Res 1997;768:215–223.
6. Wichmann T, DeLong MR. Functional and pathophysiological models of the basal ganglia. Curr Opin Neurobiol 1996;6:751–758.

7. Huang F, Gallo V. Gene structure of the rat kainate receptor
subunit KA2 and characterization of an intronic negative regulatory region. J Biol Chem 1997;272:8618 – 8627.
8. Chew LJ, Huang F, Boutin JM, Gallo V. Identification of nuclear
orphan receptors as regulators of expression of a neurotransmitter
receptor gene. J Biol Chem 1999;274:29366 –29375.
9. Bertoli-Avella AM, Giroud-Benitez JL, Bonifati V, et al. Suggestive linkage to chromosome 19 in a large Cuban family with
late-onset Parkinson’s disease. Mov Disord 2003;18:1240 –1249.
10. Pittock SJ, Joyce C, O’Keane V, et al. Rapid-onset dystonia–
parkinsonism: a clinical and genetic analysis of a new kindred.
Neurology 2000;55:991–995.

Movement Disorders, Vol. 19, No. 7, 2004

848

CLINICAL/SCIENTIFIC NOTES
Results

Spinocerebellar Ataxia Type 2 With LevodopaResponsive Parkinsonism Culminating in
Motor Neuron Disease
Jon Infante, MD,1 José Berciano, MD,1*
Victor Volpini, MD,2 Jordi Corral, MD,2
José Miguel Polo, MD,1 Julio Pascual, MD,1
and Onofre Combarros, MD1
1

Service of Neurology, University Hospital “Marqués de
Valdecilla” (University of Cantabria), Santander, Spain
2
Service of Genetics, Hospital “Durán i Reynals” (IRO),
Barcelona, Spain
Abstract: We describe an exceptional spinocerebellar ataxia
type 2 (SCA2) phenotype combining cerebellar ataxia, levodopa-responsive parkinsonism, and motor neuron symptoms.
We conclude that motor neuron symptoms and signs may be a
striking manifestation in SCA2, masking pre-existing cerebellar and extrapyramidal semeiology. © 2004 Movement Disorder Society
Key words: SCA2; parkinsonism; ALS
The clinical hallmark of spinocerebellar ataxia type 2 (SCA2)
is cerebellar gait and limb ataxia associated with slowed saccadic eye movements and hyporeflexia, but there may be considerable intra- and interfamilial variation of clinical semeiology.1– 8 We describe an exceptional SCA2 phenotype
combining cerebellar symptoms evolving to parkinsonism and
upper and lower motor neuron semeiology mimicking amyotrophic lateral sclerosis (ALS).

Subjects and Methods
This pedigree comprises 5 affected individuals in two generations, 4 of whom were examined by the authors (Fig. 1).
Informed consent was obtained from all patients and at-risk
asymptomatic adult subjects for blood sampling. The study was
approved by the Ethical Committee of the University Hospital
“Marqués de Valdecilla.” Permission for photographs was obtained from both the patient and her husband.
Genomic DNA was extracted from lymphocytes by standard
methods. Screening of dynamic CAG and CTG (SCA8) mutations associated with autosomal dominant cerebellar ataxia
(ADCA) was carried out as reported elsewhere.9

Proband Patient
In June 1994, at age 61, this woman (Case III-4 in Fig. 1)
developed gait imbalance, dysarthria, intermittent dysphagia,
and urinary urgency. A diagnosis of idiopathic late onset ataxia
(ILOCA) had been proposed elsewhere. Examination 6 months
later revealed severe gait and limb cerebellar ataxia, spasmodic
dysphonia, hyperreflexia with extensor plantar responses and
minimal weakness in the upper limbs, impassive face and
disproportionate anterocollis (Fig. 2), rigidity of all four extremities, bradykinesia, marked impairment of postural reflexes, and slowed eye saccades. We did not observe rest
tremor or fasciculations. Neither weakness of extensor neck
muscles nor difficulty in passive extension of the neck was
noted, and no orthostatic hypotension was detected. Both the
proband and her husband were unaware of any others possibly
affected in the pedigree (vide infra). The proband’s mother, 84
years of age, was asymptomatic, and her examination was
normal; the proband’s father died at age 28 during the Spanish
civil war, and examination of her daughters, then between 30
and 40 years of age, was also normal. Routine laboratory
investigations, including cerebrospinal fluid were normal.
Brain magnetic resonance imaging (MRI) study showed severe
brainstem and cerebellar atrophy (Fig. 3). Electromyography of
tibialis anterior muscle and motor conduction studies of peroneal and median nerves were normal, and a diagnosis of multiple system atrophy (MSA) was established. She was given
levodopa/carbidopa up to 600/150 mg with clear improvement
of her rigidity and bradykinesia.
As of April 1995, the patient’s clinical picture drastically
deteriorated and was accompanied by progressive generalized
weakness, persistent dysphagia, and urinary urgency and incontinence; there was no cognitive decline. In September 1995,
she was chairbound; at that time, examination revealed anarthria, severe facio-lingual-masticatory weakness, quadriparesis
(MRC grade 2-3/5), and generalized amyotrophy and fasciculations, including paraspinal, facial, and lingual muscles. There
was also marked weakness of neck flexor– extensor musculature, but extensor weakness was so marked that she adopted an
almost permanent posture of head drop (Fig. 2). Electromyography of all five muscles from upper and lower limbs revealed
profuse fibrillation and fasciculation potentials, dropout of motor units with a decreased recruitment pattern, and large long
duration of motor potentials units. Nerve conduction study was
again normal with no evidence of conduction block. The clinical picture progressed to quadriplegia and complete bulbar
palsy in the next 2 years. The patient died in September 1997
at home; an autopsy was not performed.

Other Cases in the Pedigree

*Correspondence to: José Berciano, Service of Neurology, University Hospital “Marqués de Valdecilla” (UC), 39008 Santander, Spain.
E-mail: neuro@humv.es
Received 10 October 2003; Revised 17 December 2003; Accepted
29 December 2003
Published online 16 March 2004 in Wiley InterScience (www.
interscience.wiley.com). DOI: 10.1002/mds.20090

Movement Disorders, Vol. 19, No. 7, 2004

In 1997, we evaluated Case III-6, allowing us to accurately
delineate the pedigree (Fig. 1). Case II-3 was said to have gait
ataxia and dysarthria beginning in adulthood; he died at age 75 of
brain stroke.
Case II-9 began to complain of gait instability and urinary
urgency in 1989 at age 62. Examination 10 years later
showed mild gait and limb cerebellar ataxia and dysarthria;
he was able to walk without support, and muscle reflexes
were preserved. Neither ophthalmoplegia nor signs of sensorimotor neuronopathy were noted. MRI study showed

CLINICAL/SCIENTIFIC NOTES

849

FIG. 1. Family pedigree. Plus signs indicate subjects examined by the authors. Squares represent males.

cerebellar and brainstem atrophy. Examination of his 40year-old daughter was normal.
Case III-6 is a 59-year-old woman who developed gait instability at age 53. Examination in 2001 showed mild gait and limb
cerebellar ataxia and dysarthria; she was able to walk without
support. Again neither ophthalmoplegia nor signs of sensorimotor
neuronopathy were noted. Examination of her three sons and
daughter, between 20 and 30 years of age, was normal.
Case III-8 was evaluated in 2001 at age 50. Since age 42, she
has suffered from gait instability. She referred to occasional leg
cramps. Examination showed dysarthria, slowed eye saccades,
and moderate gait and limb cerebellar ataxia, although she was
still able to walk without support. Muscle reflexes were preserved in the upper limbs and increased in the lower limbs;
plantar responses were equivocal. There was stocking hypopallesthesia. Prominent facial myokymia and widespread fasciculations in the lower limbs were observed; despite this
finding, neither leg amyotrophy nor paraparesis was noted.
Electromyography, performed elsewhere, revealed a neurogenic pattern in muscles of the lower limbs with fibrillation and
fasciculation potentials. MRI study showed brainstem and cerebellar atrophy. Examination of her two daughters, 35 and 37
years of age, was normal.

Genetic Study
DNA samples were available from cases II-9, II-15, III-4,
III-6, III-8, and III-13. Cases II-15 and III-13 showed normal
genotype (22/22 CAG repeats in both). All four clinically
affected members had an expanded allele with 35/22 (case
III-4), 36/22 (cases II-9 and III-6), and 38/22 (case III-8) repeat
CAG numbers.

Discussion
The clinical picture in the proband was initially categorized as a form of ILOCA with cerebellar-plus syndrome or
sporadic olivo-ponto-cerebellar atrophy (OPCA).10,11 Soon
after, the combination of cerebellar ataxia, bradykinesia, and
rigidity without tremor, hyperreflexia, spasmodic dysphonia,
urinary urgency, disproportionate anterocollis, slowed eye
saccades, and impairment of postural reflexes led us to
establish a working diagnosis of MSA,12 and as such was
preliminarily reported.13 As reported here, a good initial
motor response to L-dopa occurs in a third of parkinsonian

MSA patients, which may be sustained until death in 7% of
them.14 Such L-dopa–responsive parkinsonism in MSA is
accounted for by preservation of the putamen and striatal D2
sites.15,16 Appearance of florid lower motor neuron signs
mimicking ALS described here is a feature departure from
both sporadic OPCA and MSA.11,12 On that score, a couple
of clinicopathological descriptions, apparently breaking current diagnostic dogma, merit a brief comment.17,18
Kulawik and colleagues17 reported on a sporadic OPCA
patient who, at 59 years of age, developed a complex clinical
picture characterized by cerebellar ataxia, parkinsonism, cognitive decline, sphincter disturbances, and hand and forearm
amyotrophy. A diagnosis of ALS was given, which was not
supported by an autopsy study, because olivo-ponto-cerebellar
lesions were not accompanied by degeneration of anterior gray
matter of the spinal cord. In retrospect, it is not possible to
determine whether a misdiagnosis of ALS was made in this
case. Be that as it may, subclinical degeneration of anterior
horns of the spinal cord occurred in only 5 of 63 sporadic
OPCA cases reviewed by Berciano.11
Sima and coworkers18 described an MSA patient 34 years of
age, who developed rapidly progressive motor neuron disease,
nuclear ophthalmoplegia, and dysautonomic symptoms. Neuropathology showed extensive degeneration of brainstem and
spinal motor nuclei, sympathetic and parasympathetic nuclei,
striatonigral degeneration but with predominant involvement of
globus pallidus, degeneration of inferior olivary nuclei, and
glial inclusions localized in the white matter structures surrounding the putamen. Certainly this is a unique clinicopathological study and, as such, its atypical features for a diagnosis
of MSA should be interpreted very cautiously.13
The general rule in inherited disorders that detailed investigation of the pedigree is an essential step in clinical diagnosis
is applicable here. In effect, our initial evaluation comprised
just examination of the proband and all her 4 daughters; furthermore, neither the parents nor grandparents were affected by
history. Not surprisingly, we then gave a diagnosis of sporadic
neurodegenerative disorder, namely MSA. Two years later,
complete evaluation of the pedigree allowed us to detect four
additional affected members and, therefore, to establish a diagnosis of ADCA type I. After screening the dynamic mutations associated with ADCA, a diagnosis of SCA2 was set up.
Although the clinical picture, including intrafamilial variabil-

Movement Disorders, Vol. 19, No. 7, 2004

850

CLINICAL/SCIENTIFIC NOTES

FIG. 2. Serial pictures of the proband taken in January 1995 (A,B) and February 1996 (C–F; see text for chronological appearance of semeiology).
(A) Note pronounced anterocollis that her husband had noticed. (B) Impassive face. (C) Persistence of antecollis now accompanied by difficulty in
head extension (D). Note wasting of muscles of hands (E) and tongue (F).

FIG. 3. Sagittal (A) and axial (B) magnetic resonance imaging pictures of proband. Note marked atrophy of brainstem and cerebellum, with
enlargement of prepontine (large asterisk) and cerebellopontine (small asterisks) cisterns and hemispheric cerebellar sulci (arrows). Note also marked
enlargement of the fourth ventricle.

Movement Disorders, Vol. 19, No. 7, 2004

CLINICAL/SCIENTIFIC NOTES
ity, and neuroimaging findings observed in the present pedigree
are comparable to those of other SCA2 studies,4 – 8,19 two outstanding manifestations in the proband, parkinsonism and amyotrophy, deserve a comment.
Autopsy studies in SCA2 have revealed constant loss of
neurons in the substantia nigra, which is graded as moderate–
severe4 or ranging between 91% and 33% of normal (mean
reduction, 73%)20; conversely, striatum is preserved or slightly
involved. From these pathological data, it would be expected
that most SCA2 patients, as occurred in our case, would show
L-dopa–responsive parkinsonism. Intriguingly, this is not the
case, as parkinsonian semeiology is reported to be absent in
four series comprising 122 SCA2 patients4 – 6 or present in only
11 of 92 patients included in five other series7,21–24; just in one
study was bradykinesia/rigidity observed in one fifth of cases.25
The reason for such a clinicopathological discrepancy remains
unexplained; it may be that, like in OPCA, cerebellar-plus
symptomatology could mask extrapyramidal rigidity and akinesia.11 Corroborating our findings, extrapyramidal motor signs
are more frequent in late-onset than in early-onset forms,22,25
although parkinsonism has been reported in a severe early
SCA2 case with a large CAG triplet expansion.25 As illustrated
here, a SCA2 patient may be misdiagnosed as having MSA
because of the absence of family history and presence of the
constellation symptoms and signs characteristic of this disorder.24 A further connection between parkinsonism and SCA2
has come from detecting SCA2 mutation in a reduced number
of kindreds with familial L-dopa–responsive parkinsonism.26 –30
Two patients in the present pedigree showed a variable
combination of fasciculations, amyotrophy, hyperreflexia, and
extensor plantar responses, which in the proband led to quadriplegia and bulbar palsy; precisely, such coincidental semeiology argues in favour of a pathogenic role of the SCA2
mutation in the development of motor neuron dysfunction.
Furthermore, fasciculations of the face, tongue, and limb muscles are common signs in most SCA2 pedigrees4 – 8,21–24,31;
distal amyotrophy may become prominent in late stages of the
disease.32 A morphometric autopsy study in SCA2 showed
reduction of lumbar motoneurons ranging between 33% and
83% of normal (mean, 57%) and of thoracic motoneurons
between 27% and 64% (mean, 48%).20 Pyramidal signs, not
accompanied by degeneration of corticospinal tracts, are noted
in approximately one third of SCA2 cases4; this gross clinicopathological disassociation is a well-established feature in
OPCA.11 In 1983, we reported a familial OPCA with 11 affected members in four generations whose proband patient, 27
years of age, showed a cerebellar-plus syndrome not including
amyotrophy; autopsy revealed OPCA with extensive loss of
motoneurons in the thoracic and lumbosacral sections of the
spinal cord.33 In a first cousin of the proband, then 31 years of
age, we noted, in addition to cerebellar ataxia and slowed eye
saccades, generalized fasciculations and amyotrophy. In 1982,
examination of the proband’s son, then 22 years of age, was
normal. Six years later, he developed progressive ataxia, being
chairbound since 2000. Yearly examinations since 1991 have
revealed cerebellar-plus syndrome including facial myokymias,
hyporeflexia and slowed eye saccades, and widespread fasciculations and amyotrophy in the last 4 years. Molecular study in
this patient showed CAG repeat expansion in the SCA2 gene
(39/23). In short, SCA2 may show the clinicopathological
semeiology of upper and lower motor neuron disease, exceptionally mimicking ALS.

851

Disproportionate anterocollis has been noted in more than
half of pathologically proved cases of MSA.34 It does not seem
to be due to weakness, because the neck can only with difficulty
be passively and forcibly extended to its normal position, after
which the chin rapidly drops back to the sternum.34 To some
degree, these characteristics occurred in our proband patient
when the sign was first detected, although we could then extend
the neck passively. One year later, however, florid signs of
lower motoneuron dysfunction appeared, including weakness
of neck flexor– extensor muscles. Retrospectively, we interpret
that severe neck flexion was not due to dystonic disproportionate anterocollis but to early-onset dropped head syndrome
symptomatic of her motor neuron disorder.35
Acknowledgments: This work was supported by “Investigación en
Red de las Enfermedades Neurológicas” (CIEN, CO3/06, ISCIII, Madrid, Spain) and by “Fondo de Investigación Sanitaria” (02/0027).

References
1. Pulst SM, Nechiporuk A, Nechiporuk T, et al. Moderate expansion
of a normally biallelic trinucleotide repeat in spinocerebellar ataxia
type 2. Nat Genet 1996;14:269 –276.
2. Sanpei K, Takano H, Igarashi S, et al. Identification of the spinocerebellar ataxia type 2 gene using a direct identification of repeat
expansion and cloning technique, DIRECT. Nat Genet 1996;14:
277–284.
3. Imbert G, Saudou F, Ybert G, et al. Cloning of the gene for
spinocerebellar ataxia 2 reveals a locus with high sensitivity to
expanded CAG/glutamine repeats. Nat Genet 1996;14:285–291.
4. Dürr A, Smadja D, Cancel G, et al. Autosomal dominant cerebellar
ataxia type I in Martinique (French West Islands). Clinical and
neuropathological analysis of 53 patients from three unrelated
SCA2 families. Brain 1995;118:1573–1581.
5. Bürk K, Abele M, Fetter J, et al. Autosomal dominant cerebellar
ataxia type I. Clinical features and MRI in families with SCA1,
SCA2 and SCA3. Brain 1996;119:1497–1505.
6. Filla A, De Michele G, Campanella G, et al. Autosomal dominant
cerebellar ataxia type I. Clinical and molecular study of 36 Italian
families including comparison between SCA1 and ACA2 phenotypes. J Neurol 1996;142:140 –147.
7. Schöls L, Gispert S, Vorgerd M, et al. Spinocerebellar ataxia type
2. Genotype and phenotype in German kindreds. Arch Neurol
1997;54:1073–1080.
8. Giunti P, Sabbadini G, Sweeney MG, et al. The role of the SAC2
trinucleotide repeat expansion in 89 autosomal dominant cerebellar
ataxia families. Frequency, clinical and genetic correlates. Brain
1998;121:459 – 467.
9. Pujana MA, Corral J, Gratacòs M, et al. Spinocerebellar ataxias in
Spanish patients: genetic analysis of familial and sporadic cases.
Hum Genet 1999;104:516 –522.
10. Harding AE. “Idiopathic” late onset cerebellar ataxia. A clinical
and genetic study of 36 cases. J Neurol Sci 1981;51:259 –271.
11. Berciano J. Olivopontocerebellar atrophy. A review of 117 cases.
J Neurol Sci 1982;53:253–272.
12. Quinn N. Multiple system atrophy. In: Marsden CD, Fahn S,
editors. Movement disorders, 3. London: Butterworth-Heineman;
1994. p 262–281.
13. Berciano J, Combarros O, Oterino A, Pascual J. Multiple system
atrophy culminating in motor neuron disease. Mov Disord 1996;
11(Suppl.):26.
14. Wenning GK, Ben Shlomo Y, Magalhães M, Daniel SE, Quinn
NP. Clinical features and natural history of multiple system atrophy. An analysis of 100 cases. Brain 1994;117:835– 845.
15. Pascual J, Pazos A, del Olmo E, Figols J, Leno C, Berciano J.
Presynaptic parkinsonism in olivopontocerebellar atrophy: clinical,
pathological, and neurochemical evidence. Ann Neurol 1991;30:
425– 428.

Movement Disorders, Vol. 19, No. 7, 2004

852

CLINICAL/SCIENTIFIC NOTES

16. Berciano J, Valldeoriola F, Ferrer I, et al. Presynaptic parkinsonism in multiple system atrophy mimicking Parkinson’s disease: a
clinicopathological case study. Mov Disord 2002;17:812– 816.
17. Kulawik H, Roitzsch E, Barz H. Zum Krankheitsbild der olivoponto-cerebellaren Atrophie (Déjérine-Thomas). Psychiat Neurol
Med Psychol (Leipzig) 1972;3:119 –127.
18. Sima AAF, Caplan M, D’Amato CJ, Pevzner M, Furlong JW.
Fulminant multiple system atrophy in a young adult presenting as
motor neuron disease. Neurology 1993;43:2031–2035.
19. Klockgether T, Skalej M, Wedekind D, et al. Autosomal dominant
cerebellar ataxia type I. MRI-based volumetry of posterior fossa
structures and basal ganglia in spinocerebellar ataxia types 1, 2 and
3. Brain 1998;121:1687–1693.
20. Estrada R, Galarraga J, Orozco G, Nodarse A, Auburger G. Spinocerebellar ataxia 2 (SCA2): morphometric analyses in 11 autopsies. Acta Neuropathol (Berl) 1999;97:303–311.
21. Sasaki H, Fukazawa T, Wakisaka A, et al. Central phenotype and
related varieties of spinocerebellar ataxia 2 (SCA2): a clinical and
genetic study with a pedigree in the Japanese. J Neurol Sci 1996;
144:176 –181.
22. Sasaki H, Wakisaka A, Sanpei K, et al. Phenotype variation correlates with CAG repeat length in SCA2. A study of 28 Japanese
patients. J Neurol Sci 1998;159:202–208.
23. Ueyama H, Kumamoto T, Nagao S, Mita S, Uchino M, Tsuda T.
Clinical and genetic studies of spinocerebellar ataxia type 2 in
Japanese kindreds. Acta Neurol Scand 1998;98:427– 432.
24. Lee WY, Jin DK, Oh MR, et al. Frequency analysis and clinical
characterization of spinocerebellar ataxia types 1, 2, 3, 6, and 7 in
Korean patients. Arch Neurol 2003;60:858 – 863.
25. Schöls L, Peters S, Szymanski S, et al. Extrapyramidal motor signs
in degenerative ataxias. Arch Neurol 2000;57:1495–1500.
26. Gwinn-Hardy K, Chen JY, Liu HC, et al. Spinocerebellar ataxia
type 2 with parkinsonism in ethnic Chinese. Neurology 2000;55:
800 – 805.
27. Shan DE, Soong BW, Sun CM, Lee SJ, Liao KM, Liu RS.
Spinocerebellar ataxia type 2 as familial levodopa-responsive parkinsonism. Ann Neurol 2001;50:812– 815.
28. Furtado S, Farrer M, Tsuboi Y, et al. SCA-2 presenting as parkinsonism in an Alberta family. Clinical, genetic, and PET findings.
Neurology 2002;59:1625–1627.
29. Payami H, Nutt J, Gancher S, et al. SCA2 may present as levodopa-responsive parkinsonism. Mov Disord 2002;18:425– 429.
30. Lu CS, Chou YW, Yen TC, Tsai CH, Chen RS, Chang HC.
Dopa-responsive parkinsonism phenotype of spinocerebellar type
2. Mov Disord 2002;17:1046 –1051.
31. Pareyson D, Gellera C, Castellotti B, et al. Clinical and molecular
studies of 73 Italian families with autosomal dominant cerebellar
ataxia type I: SCA1 and SCA2 are the most common phenotypes.
J Neurol 1999;246:389 –393.
32. Bürk K, Stevanin G, Didierjean O, et al. Clinical and genetic
analysis of three German kindreds with autosomal dominant cerebellar ataxia type I linked to the SCA2 locus. J Neurol 1997;244:
256 –261.
33. Berciano J, Ricoy JR, Rebollo M, Combarros O, Coria F, Val F.
Atrofia olivopontocerebelosa familiar (tipo Menzel). A propósito
de una estirpe seguida durante 46 años. Arch Neurobiol (Madrid)
1983;46:51–58.
34. Quinn N. Disproportionate antecollis in multiple system atrophy.
Lancet 1989;1:844.
35. Gourie-Devi M, Nalini A, Sandhya S. Early or late appearance of
“dropped head syndrome” in amyotrophic lateral sclerosis. J Neurol Neurosurg Psychiatry 2003;74:683– 686.

Pregnancy in Stiff-Limb Syndrome
Stuart J.M. Weatherby, MD, MRCP1
Philippa Woolner, MBChB,1
and Carl E. Clarke, MD, FRCP1,2*
1

Department of Neurology, City Hospital, Birmingham,
United Kingdom
2
University of Birmingham, Birmingham, United Kingdom
Abstract: To our knowledge, pregnancy in a patient with stifflimb-syndrome (SLS) has not been reported. We present the case
of a woman with SLS who improved during pregnancy, delivered
a normal healthy baby by forceps-assisted vaginal delivery, and
suffered a mild postpartum “relapse.” © 2004 Movement Disorder Society
Key words: stiff-person syndrome; stiff-limb syndrome;
pregnancy
Stiff-person and stiff-limb syndromes (SPS and SLS, respectively) are rare, related conditions characterised by muscle
stiffness, rigidity, and spasms. An autoimmune pathogenesis
has been postulated. To our knowledge, there is no previous
reported case of pregnancy in a patient with either SPS or SLS.
Management decisions, therefore, may be difficult in such a
situation. We present the case of a 41-year-old woman with
SLS who became pregnant.

Case Report
This 41-year-old woman was diagnosed with SLS at the
National Hospital for Neurology and Neurosurgery in 1994 by
Professor Marsden after a 4-year history of falls and lower limb
muscle spasms. She eventually developed opisthotonos and
severe falls with injuries as a result of stimulus-induced
spasms. The patient noted that loud noises could precipitate
spasm of the legs and that the rigidity and spasm became worse
on standing or attempting to walk; her symptoms improved
with alcohol and diazepam. There was no bladder or bowel
disturbance, and the family history was unremarkable. When
she was referred to us in 2002, examination revealed increased
tone in the legs with brisk reflexes and bilateral flexor plantar
responses; sensation was not affected, and examination of the
cranial nerves and upper limbs was normal.
Investigations performed at the time of diagnosis included a
full autoimmune screen which was negative; her anti-glutamic
acid decarboxylase (GAD) antibody level was normal. The test
was immunohistochemical, using IgG and IgM antibodies directed against rat cerebellum. Antibodies against isolated human Purkinje cells, cerebral cortex neurones, and central nervous system (CNS) white matter were also negative.

*Correspondence to: Dr. Carl E. Clarke, Neurology Department,
City Hospital, Dudley Road, Birmingham B18 7QH, United Kingdom.
E-mail: c.e.clarke@bham.ac.uk
Received 15 September 2003; Revised 9 December 2003; Accepted
5 January 2004
Published online 16 March 2004 in Wiley InterScience (www.
interscience.wiley.com). DOI: 10.1002/mds.20094

Movement Disorders, Vol. 19, No. 7, 2004

CLINICAL/SCIENTIFIC NOTES
Examination of the cerebrospinal fluid revealed oligoclonal
bands. A magnetic resonance imaging scan and nerve conduction studies were normal. Electromyography revealed persistent
motor unit firing in tibialis anterior and vastus, but not in the
paraspinal muscles, consistent with a diagnosis of stiff-limb
syndrome.
She was initially treated with baclofen and diazepam, which
prevented further opisthotonus and most of her falls. A course
of intravenous methylprednisolone gave little benefit. The possibility of intrathecal baclofen was considered at this time, but
because the patient remained relatively well, she was kept on
oral medication, remained clinically stable, and was able to
hold down a busy job. She would use a wheelchair at work but,
when at home, was able to move around the house using the
support of rails and furniture. She was able to control most of
the spasms with high doses of baclofen and diazepam (100 mg
and 60 mg per day, respectively).
She became pregnant in 2002. The pregnancy itself was
unremarkable; both maternal and foetal parameters remained
within normal limits. One of our main concerns was the risk of
side effects of both baclofen and diazepam on the foetus.
However, the patient managed to reduce the dose of baclofen to
25 mg and diazepam to 15 mg per day. She was able to reduce
her medication doses from the second trimester onward, as she
found that her symptoms were improving significantly and her
spasms, especially those in her legs, occurring less frequently.
The birth itself was complicated by foetal distress, which
required assisted forceps delivery. Although the patient had an
epidural for analgesia, she developed a generalised spasm in
response to the pain of the episiotomy. The baby remained well
with no features of sedation or withdrawal fits, did not require
any benzodiazepines and did not become drowsy, despite being
breast fed.
After parturition, she deteriorated with increasing stiffness of
the legs and stimulation-induced leg spasms. As a result, she
increased the baclofen to 100 mg daily and the diazepam to 35
mg daily over 2 months, which improved the symptoms progressively, and the noise induced spasms that were particularly
troublesome became less frequent. She remains optimistic that
she can cope with her child, managing to nurse her on her lap
while using the wheelchair. She is keen to have another baby,
despite the limitations of her condition.

Discussion
SPS was first described in 1956 by Moersh and Woltman.1
Initially, it affects the axial muscles leading to back discomfort
but, as the condition progresses, proximal limb muscles become involved. Startle may lead to prolonged and painful
spasms of both axial and limb muscles. Apart from the motor
disorder, neurological examination is normal and intellect is
preserved.
SPS has been subdivided into cases in which rigidity and
spasms in the axial musculature dominate and those with spasm
in one or more limbs, the so-called stiff limb syndrome; it has
been suggested that SLS may be a condition distinct from
SPS.2,3 A further and more unusual subgroup (progressive
encephalomyelitis with rigidity) also has been described in
which patients have a rapidly progressive condition characterised by widespread rigidity resulting in death in 6 to 16 weeks.3
The disease is sporadic: early suggestions that SPS was more
common in males 4 have not been substantiated in more recent
studies.5 Insulin-dependent diabetes mellitus (IDDM) is asso-

853

ciated with SPS, the frequency of IDDM in patients with SPS
having been estimated at more than 30 times that in the general
population.5
SPS is associated in 70% of cases with serum autoantibodies
to glutamic acid decarboxylase (GAD 65), the rate limiting
enzyme for the synthesis of gamma-aminobutyric acid
(GABA). An autoimmune pathogenesis within the CNS is
suggested by the finding of intrathecal synthesis of anti–GAD
IgG antibodies. Around 5% of patients have antibodies to
amphiphysin and very rarely antibodies to gephyrin; the disease
may be associated with cancer in this group.6 Anti–GAD 65
antibodies have been reported to be uncommon in SLS,5 and
our patient was anti–GAD 65 negative. Nonetheless, an autoimmune process would appear likely for such patients, and the
rationale for treatment (including for patients in whom autoantibodies have not been isolated) is based upon this premise.
It is, however, important to note that recent series have suggested that anti–GAD 65 antibodies in SLS may be more
common than previously recognized.7
To our knowledge, no case of pregnancy in a patient with
SPS or SLS has been reported, so we had little evidence on
which to base our counselling of the patient regarding care
during pregnancy, delivery, the postnatal period, and care of the
baby. One of our concerns was the possible risk of transplacental passage of putative autoantibodies causing a transient
neonatal SPS, in a manner analogous to neonatal myasthenia
gravis. The effects of baclofen and diazepam on the foetus were
uncertain, and in addition, it was not known whether her
disease would be affected by pregnancy and labour.
The clinical course of this patient during pregnancy is interesting: she improved during pregnancy but deteriorated soon
after. Such a variation is in keeping with an autoimmune
process and may be considered similar to the situation that
occurs in multiple sclerosis, in which the rate of relapse decreases during pregnancy and increases in the first 3 months
after delivery,8 which raises the possibility that sex hormones
may act to modulate disease course in SPS. This possibility is
not surprising, as exogenous steroids and intravenous immunoglobulin6,9 have proved an effective treatment for severe
cases of SPS. We acknowledge, however, that it is also possible
that the increase in severity after delivery may have been a
return to baseline rather than a true relapse. In this context, it is
important to note that, although the patient had to increase her
medication after delivery, the increase did not reach prepregnancy levels.
That the patient was able to proceed with a vaginal delivery
and delivered a healthy baby is encouraging for other GAD 65
antibody-negative women with SLS contemplating pregnancy.
It is important to note that, despite the mother’s medication, the
newborn baby was not sedated or floppy. Assuming that an
autoantibody is involved in GAD 65 antibody-negative cases of
SLS, it would appear that they are either not causative or do not
cross the placenta in sufficient quantities to cause significant
clinical effects; clearly no conclusions can be drawn from this
case regarding GAD 65 antibody-positive patients. We hope
that this single case report and the tentative inferences herein
may prove useful to other clinicians facing a similar situation.

References
1. Moersh FP, Woltman HW. Progressive fluctuating muscular rigidity
and spasm (“stiff-man” syndrome): report of a case and some
observations in 13 other cases. Mayo Clin Proc 1956;31:421– 427.

Movement Disorders, Vol. 19, No. 7, 2004

854

CLINICAL/SCIENTIFIC NOTES

2. Brown P, Rothwell JC, Marsden CD. The stiff-leg syndrome. J Neurol Neurosurg Psychiatry 1997;62:31–37.
3. Barker RA, Revesz T, Thom M, Marsden CD, Brown P. Review of
23 patients affected by the stiff man syndrome: clinical subdivision
into stiff trunk (man) syndrome, stiff limb syndrome, and progressive encephalomyelitis with rigidity. J Neurol Neurosurg Psychiatry
1998;65:633– 640.
4. Gordon EE, Januszko DM, Kaufman L. A critical survey of stiff
man syndrome. Am J Med 1967;42:582–599.
5. Blum P, Jankovic J. Stiff person syndrome: an autoimmune disease.
Mov Disord 1991;6:12–20.
6. Vasconcelos OM, Dalakas MC. Stiff-person syndrome. Curr Treat
Options Neurol 2003;5:79 –90.
7. Meinck HM, Thompson PD. Stiff man syndrome and related conditions. Mov Disord 2002;17:853– 866.
8. Confavreux C, Hutchinson M , Hours MM, Cortinovis-Tourniaire P,
Moreau Th, and the Pregnancy in Multiple Sclerosis Group. Rate of
pregnancy - related relapse in multiple sclerosis. N Engl J Med
1998;339:285–291.
9. Wiles CM, Brown P, Chapel H, et al. Intravenous immunoglobulin
in neurological disease: a specialist review. J Neurol Neurosurg
Psychiatry 2002;72:440 – 448.

Markedly Asymmetrical Parkinsonism as a
Leading Feature of Adult-Onset
Huntington’s Disease
Shih-Ching Wang, MD,1 Guey-Jen Lee-Chen, PhD,2
Cheng-Kung Wang, MD,2,3 Chiung-Mei Chen, MD, PhD,1
Lok-Ming Tang, MD, MSc,1 and Yih-Ru Wu, MD1*
1

Second Department of Neurology, Chang Gung Memorial
Hospital, LinKou Medical Center, Taipei, Taiwan
2
Department of Life Science, National Taiwan
Normal University, Taipei, Taiwan
3
Jen-Teh Junior College of Medicine, Nursing and
Management, Miaoli, Taiwan

Abstract: We report on a 28-year-old man who presented with
right hand tremor, bradykinesia, and rigidity of his right side
extremities. Our case report emphasizes that markedly asymmetrical parkinsonism can be an initial presentation of adult-onset
Huntington’s disease (HD), and different clinical presentations can
be observed in members of an individual HD family with the same
CAG repeat length. © 2004 Movement Disorder Society
Key words: hemiparkinsonism; Huntington’s disease; anticipation

This article includes Supplementary Video, available online at http://
www.interscience.wiley.com/jpages/0885-3185/suppmat
*Correspondence to: Dr. Yih-Ru Wu, Second Department of Neurology, Chang Gung Memorial Hospital, 199, Tung Hwa North Road,
Taipei, Taiwan. E-mail: yihruwu@adm.cgmh.org.tw
Received 20 August 2003; Revised 11 December 2003; Accepted 6
January 2004
Published online 16 March 2004 in Wiley InterScience (www.
interscience.wiley.com). DOI: 10.1002/mds.20093

Movement Disorders, Vol. 19, No. 7, 2004

Huntington’s disease (HD) is an autosomal dominant neurodegenerative disorder caused by an unstable expansion of a CAG
trinucleotide repeat in the IT15 gene in the short arm of chromosome 4.1 The classic presentation includes midlife onset of
chorea, dementia, personality disorders, and a positive family
history; dystonia and parkinsonism features usually appear later
in the disease as it progresses.2 A small number of patients may
present with motor symptoms other than chorea.3,4 The “Westphal” variant is usually seen in juvenile-onset HD, and rarely
seen in adult-onset disease. The phenotype is characterized by
akinesia, rigidity, conspicuous mental deterioration, seizures,
myoclonus, dystonia, pyramidal signs with rapid deterioration,
and an affected father.5 Hemiparkinsonism is very rare in HD.
We report a patient with genetically confirmed HD who had
asymmetric parkinsonism as an initial presentation.

Case Report
A 28-year-old, right-handed man who had been well until the
age of 26 years, when he developed involuntary tremor-like
movements of his right hand. These tremors occurred mainly
during action, rarely at rest, and could not be suppressed
voluntarily. He noted gradual onset of stiffness in his right hand
and difficulty in performing daily activities such as using
chopsticks and writing. One year later, he developed clumsiness in his right leg during walking and his gait became slow
and unsteady. He worked in a factory where he has not been
exposed to solvents or any toxin. Between the age of 25 and 27,
he developed an anxiety state and his social status deteriorated
with suspiciousness with aggression. There was no history of
encephalitis or exposure to neuroleptics antiemetics or herbicide. His father and his paternal aunt were thought to have
stroke and psychosis, respectively.
On physical examination, the patient was alert and orientated. His mentality was good and language ability was preserved. He had a masked face, his speech was fluent, and there
were no Kayser–Fleischer (KF) rings. Neurological examination was unremarkable except a postural and action tremor in
his right hand, cogwheel rigidity and dystonia in his right wrist,
bradykinesia of both limbs, more severely involved on the
right, and decreased arm swing on the right side. No myoclonus
or chorea was seen. Neuropsychological assessment revealed
normal social function but with significant cognitive deficits,
including verbal learning, executive function, visual perceptual
function, and some psychopathological manifestations of obsessive– compulsive symptoms and hostility such as suspiciousness with aggression and loss of temper.
Normal or negative laboratory investigations included thyroid function, vitamin B12 level, blood copper and ceruloplasmin values, antinuclear antibody, and acanthocyte screen. Magnetic resonance image scan of the brain was normal, with no
atrophy of cerebrum or striatum.
The patient was initially diagnosed as young-onset Parkinson’s disease. Treatment with carbidopa/levodopa (25/100 mg)
and pergolide (0.25 mg) three times a day produced a moderate
motor improvement, including reduction of tremor and bradykinesia and improvement in gait. He had no untoward effects
from the dopaminergic treatment. Because of an uncertain
family history and lack of significant benefit from levodopa
(L-dopa), genetic tests for HD, spinocerebellar ataxia (SCA)
type 1–3,6 – 8,10,12,17 and dentatorubro-pallidolusian atrophy
(DRPLA) were carried out. Screening for the expansion mutation in the HD gene by polymerase chain reaction assay re-

CLINICAL/SCIENTIFIC NOTES

855

FIG. 1. Pedigree of the family. Arrow indicates the proband; black symbols denote affected persons; unaffected individuals are represented by
unblackened symbols. Symbols with slashes represent deceased individuals; symbols with a question mark represent individuals with undetermined
status.

vealed one allele containing 23 repeats and another allele
containing 44 repeats confirming the diagnosis. Later, his father
was proven to have HD carrying 2 alleles with 17 repeats and
44 repeats, respectively (Fig. 1). He had chorea, dementia, and
some cognitive deficits typical of HD. At 2-years follow-up, the
patient has continuing L-dopa responsiveness and no deterioration in cognitive function.

Discussion
We report on an adult-onset HD patient having marked
asymmetrical, partially dopa-responsive parkinsonism without chorea, which is unusual. Although genetic testing was
consistent with HD, other diseases may coexist. Parkin
disease was considered in this case, the key clinical features
being young age at onset (usually ⬍40 years), foot dystonia,
psychiatric symptoms, dramatic response to L-dopa treatment, and dose-dependent motor and psychiatric complications of drug therapy.6,7 This patient received carbidopa–Ldopa and pergolide for 2 years and obtained only moderate
improvement in his tremor, bradykinesia, and unsteady gait,
which made this diagnosis unlikely. Other confounding diagnoses, including drug-induced parkinsonism, Wilson’s
disease, neuroacanthocytosis, SCA, and DRPLA, were excluded by the history and laboratory test.
HD is generally regarded as a hyperkinetic syndrome. Besides chorea, patients with HD show a marked impairment of
voluntary movement, which includes akinesia (inability to ini-

tiate), bradykinesia (slow execution of movement), and hypokinesia (reduction of movement).8 –11 Albin and colleagues12
found a profound nonselective loss of all striatal projection
neurons, including those projecting to the globus pallidus externa, globus pallidus interna (GPi), and substantia nigra (SN)
in akinetic rigid HD with no reduction of neurons containing
tyrosine hydroxylase in the SN, whereas those patients with HD
with chorea had relative preservation of projections to the GPi.
As nigrostriatal neurons containing dopamine were presumably
preserved, the authors argued that the additional degeneration
of the direct pathway might underlie the parkinsonian HD
phenotype.
Patients with the late-onset hypokinetic-rigid form of HD
have been reported to benefit from L-dopa.13,14 Therefore, we
assumed the mechanism of L-dopa responsiveness is due to
partially restore the activity of striatal projection neurons to the
GPi. It is unusual for the patient and his father to have different
clinical presentations but carry the same number of CAG
triplets (47) on the IT15 gene. The lack of anticipation in this
family is also an uncommon feature.15
In conclusion, genetic examination is a useful diagnostic tool
in patients with atypical forms of HD, especially in those with
a family history of neurological or psychological disorders.
L-Dopa–responsive, markedly asymmetrical parkinsonism may
also be a presenting feature of adult-onset HD. Our patient
further broadens the considerable clinical heterogeneity of
movement disorders reported in late-onset HD.

Movement Disorders, Vol. 19, No. 7, 2004

856

CLINICAL/SCIENTIFIC NOTES

Acknowledgments: We thank Professor Anthony E. Lang, Director
of Movement Disorders Clinic, Toronto Western Hospital, for his
invaluable assistance, and we also thank the participating patient for his
cooperation.

Legend to the Video
Facial expression and the speech are normal. Moderate bradykinesia and rigidity, and mild action and postural tremor of
the right hand are seen. Decreased arm swing and dystonic
posturing of his right arm are noted during walking. Mild
slowness of movement is also present in the left side.

References
1. A novel gene containing a trinucleotide repeat that is expanded and
unstable on Huntington’s disease chromosomes. The Huntington’s
Disease Collaborative Research Group. Cell 1993;72:971–983.
2. Louis ED, Lee P, Quinn L, Marder K. Dystonia in Huntington’s
disease: prevalence and clinical characteristics. Mov Disord 1999;
14:95–101.
3. Squitieri F, Berardelli A, Nargi E, et al. Atypical movement
disorders in the early stages of Huntington’s disease: clinical and
genetic analysis. Clin Genet 2000;58:50 –56.
4. Di Maio L, Squitieri F, Napolitano G, Campanella G, Trofatter JA,
Conneally PM. Onset symptoms in 510 patients with Huntington’s
disease. J Med Genet 1993;30:289 –292.
5. Bittenbender JB, Quadfasel FA. Rigid and akinetic forms of Huntington’s chorea. Arch Neurol 1962;7:275–288.
6. Shimura H, Hattori N, Kubo SI, et al. Familial Parkinson disease
gene product, parkin, is a ubiquitin-proteinligase. Nat Genet 2000;
25:302–305.
7. Khan NL, Graham E, Critchley P, et al. Parkin disease: a phenotypic study of a large case series. Brain 2003;126(Pt 6):1279 –
1292.
8. van Vugt JP, van Hilten BJ, Roos RA. Hypokinesia in Huntington’s disease. Mov Disord 1996;11:384 –388.
9. van Vugt JP, Siesling S, Piet KK, et al. Quantitative assessment of
daytime motor activity provides a responsive measure of functional
decline in patients with Huntington’s disease. Mov Disord 2001;
16:481– 488.
10. Berardelli A, Noth J, Thompson PD, et al. Pathophysiology of
chorea and bradykinesia in Huntington’s disease. Mov Disord
1999;14:398 – 403.
11. Garcia Ruiz PJ, Gomez Tortosa E, Sanchez Bernados V, Rojo A,
Fontan A, Garcia de Yebenes J. Bradykinesia in Huntington’s
disease. Clin Neuropharmacol 2000;23:50 –52.
12. Albin RL, Reiner A, Anderson KD, Penney JB, Young AB. Striatal
and nigral neuron subpopulations in rigid Huntington’s disease:
implications for the functional anatomy of chorea and rigidityakinesia. Ann Neurol 1990;27:357–365.
13. Racette BA, Perlmutter JS. Levodopa responsive parkinsonism in
an adult with Huntington’s disease. J Neurol Neurosurg Psychiatry
1998;65:577–579.
14. Reuter I, Hu MT, Andrews TC, Brooks DJ, Clough C, Chaudhuri
KR. Late onset levodopa responsive Huntington’s disease with
minimal chorea masquerading as Parkinson plus syndrome. J Neurol Neurosurg Psychiatry 2000;68(2):238 –241.
15. Ashizawa T, Wong LJ, Richards CS, Caskey CT, Jankovic J. CAG
repeat size and clinical presentation in Huntington’s disease. Neurology 1994;44:1137–1143.

Movement Disorders, Vol. 19, No. 7, 2004

Distressing Belching and Neuroacanthocytosis
Igor Sibon, MD,* Imad Ghorayeb, MD, PhD,
Pierre Arné, MD, and François Tison, MD, PhD
Fédération de Neurosciences Cliniques, Centre Hospitalier
Universitaire Bordeaux, Bordeaux-cedex, France

Abstract: We report on an uncommon manifestation of molecularly proven neuroacanthocytosis in a 32-year-old man in
whom dyspnea with desaturation while awake accompanied by
continuous involuntary belching were the major consequences
of the disease. © 2004 Movement Disorder Society
Key words: neuroacanthocytosis; belching
Belching is a complex physiological action due to gastropharyngeal reflux of air. Although mostly associated with gastrointestinal disorders,1 it occasionally accompanies movement
disorders such as Parkinson’s disease (PD) and Huntington’s
disease (HD).2,3 Neuroacanthocytosis (CA) is an autosomal
recessive movement disorder caused by several mutations in
the CHAC gene on 9q21.4 The classic clinical picture of CA
includes movement disorders (mainly chorea, epileptic seizures, cognitive deterioration, peripheral neuropathy) and some
psychiatric manifestations.5 Although the orofacial region is
often affected by choreic movements, tics, lip and tongue
biting, continuous belching has not been reported in CA. We
report on a patient with molecularly confirmed CA who developed progressive distressing belching and suggest that this
curious disorder may be due to complex dystonic contractions
of the diaphragm leading to abnormal respiratory rhythms and
aerophagia.

Case Report
A 32-year-old, right-handed North African man presented
with longstanding continuous belching. For the previous 7
years he had had chorea, dysarthria, and recurrent generalized
epileptic seizures controlled by gabapentin (1,800 mg/day) and
phenobarbital (100 mg/day). Fresh blood smear of the patient
disclosed 10% acanthocytes. He had one sister who died at the
age of 30 years with disabling movement disorders and another
who currently presented with chorea, cerebellar signs, and
psychiatric disturbances with self-aggressive behavior. Both
were born from parental consanguinity.
Screening for the CHAC gene mutation by polymerase chain
reaction assay revealed the same intronic mutation as that

This article includes Supplementary Video, available online at http://
www.interscience.wiley.com/jpages/0885-3185/suppmat
*Correspondence to: Dr. Igor Sibon, Service de Neurologie, Hopital
Pellegrin, Place Amélie Raba-Léon, 33076 Bordeaux cedex, France.
E-mail: igor.sibon@chu-bordeaux.fr
Received 15 September 2003; Revised 10 December 2003; Accepted
9 January 2004
Published online 16 March 2004 in Wiley InterScience (www.
interscience.wiley.com). DOI: 10.1002/mds.20091

CLINICAL/SCIENTIFIC NOTES

857

FIG. 1. A: Four-minute polysomnographic recording during wakefulness and drowsiness showing an irregular breathing pattern with prolonged
central apnea and recurrent desaturation. CA, central apnea; Des, desaturation. B: Four-minute polysomnographic recording during stage 2 of sleep,
showing regular breathing pattern without apnea or desaturation. (EOG, electro-oculogram; EMG1, chin electromyogram; ECG, electrocardiogram;
NAF1, nasobuccal airflow (thermistance); NAF2, nasal airflow pressure; VAB, abdomino-thoracic effort; Phono, microphone; SAO2, oxygen
saturation; EMG2, tibialis anterior electromyogram; PR, pulse rate). Scale bar ⫽ 10 sec.

found in his sister, which led to the molecular confirmation of
CA (intron 26; 4242⫹1G⬎T; leading to aberrant splicing). On
examination, lower limb deep tendon reflexes were absent, as
well as moderate cerebellar signs (limb ataxia) and mild cognitive deterioration; chest radiography was normal as was a
magnetic resonance imaging brain scan. Electroencephalography showed bilateral slow waves without epileptic features. For
a year he had had continuous and distressing tasteless belching
associated with aerophagia without swallowing disorders, dysphagia, or other symptoms of gastroesophageal reflux. The
frequency of the belching had increased over that time and was
affected by posture as belching only disappeared when the
patient was in the supine position, whether asleep or not (see
Video, Segment 1). He also had concomitant and recurrent
episodes of dyspnea presenting as sensations of shortness of
breath. Abdominal radiography showed air dilatation of the
entire gastrointestinal tract. Endoscopy of the upper gastrointestinal tract was normal. Videofluoroscopy showed normal

deglutition and swallowing process with slight hypotonia of the
inferior esophageal sphincter (IOS) that was confirmed by
esophageal manometry. All-night polysomography (PSG) with
audio and video monitoring revealed irregular episodes of
involuntary deep inspiration breathing followed by central apneas with arterial oxygen desaturation (up to 88%), then belching (Fig. 1A). These episodes occurred during wakefulness and
were influenced by body position changes, speech, and effort,
and persisted with attenuation during drowsiness. They disappeared during deep sleep, while a regular respiration pattern
was noted with no oxygen desaturation (Fig. 1B). Electromyography of the diaphragmatic muscle with concentric needle
electrodes did not disclose any diaphragmatic flutter, but did
demonstrate repetitive recurrent arrhythmic and prolonged contractions of both diaphragmatic domes, concomitant with
breathing irregularities (Fig. 2); phrenic nerve latencies were
normal. Several treatment strategies failed to control the belching, including trials with neuroleptics, benzodiazepine, and

Movement Disorders, Vol. 19, No. 7, 2004

858

CLINICAL/SCIENTIFIC NOTES

FIGURE 1. (Continued)

dopamine agonists, including apomorphine and levodopa (a
L-dopa acute challenge test was performed with 250 mg of
L-dopa/bensezaride under fasting conditions and 2 days under
domperidone, 60 mg/day).

Discussion
Belching is a physiological gastrointestinal activity that relieves distension of the gastric cardia and esophagus by oral
expulsion of air inadvertently swallowed with meals.1 Subjects

who complain of excessive belching are seldom found to have
organic gastrointestinal disease and volitional aerophagia due
to psychological factors may be suspected.6,7 Belching has
already been encountered in neurodegenerative disorders, episodic belching during off periods with temporary improvement
in response to L-dopa and apomorphine has been reported in 2
patients with PD.2 Esophageal dystonia secondary to a disturbed striatal dopamine neurotransmission or Lewy body pathology in the dorsal vagal nucleus and the myenteric plexus

FIG. 2. Diaphragmatic electromyogram: arrhythmic prolonged contractions of the diaphragm during 250 msec
with a 0.6 mV amplitude.

Movement Disorders, Vol. 19, No. 7, 2004

CLINICAL/SCIENTIFIC NOTES
has been suggested as an underlying mechanism.8 Belching
was also reported in a patient with HD with no response to
dopamine agonists or neuroleptics.3 In CA, chorea is the most
common movement disorder, but dystonia, tics, and parkinsonian features also occur.9,10 To our knowledge, involuntary
belching has not been described previously in CA, and in our
case, belching was the most disabling symptom of the disease.
Gastroesophageal investigations did not disclose any disturbed
upper oesophageal sphincter function nor esophageal abnormalities such as spasmodic contractions as previously described in PD and HD cases.2,3 Moreover, no improvement, as
previously described in belching associated to PD was observed after L-dopa treatment.2 However, EMG revealed abnormal contractions of the diaphragmatic muscle, suggesting
focal diaphragmatic dysfunction that can be characterized as a
dystonic movement disorder. This was further confirmed by
PSG showing bursts of irregular breathing rhythm with
central apneas. “Dystonic” breathing has been described in
both primary and secondary dystonia11 and was associated
with spasmodic contractions of the upper airways and/or the
diaphragm in most patients. Sleep and supine posture were
associated with a reduction or cessation of belching and
breathing irregularities, which is a common feature of dystonia and further underlines the diaphragmatic origin of
these symptoms in our patient.
Indeed the phrenic nerve latencies were normal, as was the
contractile response of the diaphragm, a finding which suggests
that the peripheral nerve muscle axis is intact and favors a
central origin of the diaphragmatic dysfunction observed in our
patient. Abnormalities of striatal dopamine neurotransmission
are well known both in CA and in PD and HD.12 Evidence for
disturbed dopaminergic neurotransmission in living patients
with CA was provided by in vivo positron emission tomographic studies.12 In addition, neuropathological studies revealed thalamic and nigral involvement, thus suggesting a role
of the dopaminergic system in the occurrence of the movement
disorders in CA.13,14 Our patient had no parkinsonian features
but a slight chorea improved by neuroleptics, therefore pointing
to a predominant postsynaptic striatal dysfunction accounting
for the lack of efficacy of apomorphine. We suggest that
diaphragmatic dystonic dysfunction of central origin is the
primary disorder in our case, and this is further supported by
postural modifications of belching occurrence. Consequent severe dysrhythmic respiration leading to aerophagia through
hypotonic IOS may, at least in part, be responsible for this
recurrent belching. However, a more complex origin of this
rare disorder cannot be ruled out.

859

3. Hu MT, Chaudhuri KR. Repetitive belching, aerophagia, and torticollis in Huntington’s disease: a case report. Mov Disord 1998;
13:363–365.
4. Dobson-Stone C, Danek A, Rampoldi L, et al. Mutational spectrum
of the CHAC gene in patients with chorea-acanthocytosis. Eur J
Hum Genet 2002;10:773–781.
5. Critchley EM, Clark DB, Wikler A. An adult form of acanthocytosis. Trans Am Neurol Assoc 1967;92:132–137.
6. Levitt MD, Lasser RB, Schwartz JS, Bond JH. Studies of a
flatulent patient. N Engl J Med 1976;295:260 –262.
7. Zella SJ, Geenens DL, Horst JN. Repetitive eructation as a manifestation of obsessive-compulsive disorder. Psychosomatics 1998;
39:299 –301.
8. Qualman SJ, Haupt HM, Yang P, Hamilton SR. Esophageal Lewy
bodies associated with ganglion cell loss in achalasia. Similarity to
Parkinson’s disease. Gastroenterology 1984;87:848 – 856.
9. Hardie RJ, Pullon HW, Harding AE, et al. Neuroacanthocytosis. A
clinical, haematological and pathological study of 19 cases. Brain
1991;114:13– 49.
10. Spitz MC, Jankovic J, Killian JM. Familial tic disorder, parkinsonism, motor neuron disease, and acanthocytosis: a new syndrome. Neurology 1985;35:366 –370.
11. Braun N, Abd A, Baer J, Blitzer A, Stewart C, Brin M. Dyspnea in
dystonia. A functional evaluation. Chest 1995;107:1309 –1316.
12. Brooks DJ, Ibanez V, Playford ED, et al. Presynaptic and postsynaptic striatal dopaminergic function in neuroacanthocytosis: a
positron emission tomographic study. Ann Neurol 1991;30:166 –
171.
13. Rinne JO, Daniel SE, Scaravilli F, Harding AE, Marsden CD.
Nigral degeneration in neuroacanthocytosis. Neurology 1994;44:
1629 –1632.
14. Rinne JO, Daniel SE, Scaravilli F, Pires M, Harding AE, Marsden
CD. The neuropathological features of neuroacanthocytosis. Mov
Disord 1994;9:297–304.

Legend to the Video
Recurrent belching and episodes of dyspnea.

References
1. Clearfield HR. Clinical intestinal gas syndromes. Prim Care 1996;
23:621– 628. 2. Kempster PA, Lees AJ, Crichton P, Frankel JP,
Shorvon P. Off-period belching due to a reversible disturbance of
oesophageal motility in Parkinson’s disease and its treatment with
apomorphine. Mov Disord 1989;4:47–52.
2. Kempster PA, Lees AJ, Crichton P, Frankel JP, Shorvon P. Offperiod belching due to a reversible disturbance of oesophageal
motility in Parkinson’s disease and its treatment with apomorphine. Mov Disord 1989;4:47–52.

Movement Disorders, Vol. 19, No. 7, 2004

860

CLINICAL/SCIENTIFIC NOTES

Observations on the Human Rejection
Behaviour Syndrome: Denny–Brown Revisited
Jason D. Warren, FRACP,1 Michele T.M. Hu, MRCP, PhD,2
Malcolm Galloway, BSc, MBBS,3
Richard J. Greenwood, MD, FRCP,2
and Martin N. Rossor, MD, FRCP1,2*
1

Dementia Research Group, Institute of Neurology,
Queen Square, London, United Kingdom
2
National Hospital for Neurology and Neurosurgery,
Queen Square, London, United Kingdom
3
Division of Neuropathology, Institute of Neurology,
Queen Square, London, United Kingdom

Abstract: The parietal avoiding–rejection behaviour syndrome, first described by Denny-Brown in the rhesus monkey,
has been reported only rarely in humans. Here, we describe a
patient with rejection behaviour in the setting of progressive
cognitive decline accompanied by cortical myoclonus. © 2004
Movement Disorder Society
Key words: parietal avoiding syndrome; rejection behaviour; myoclonus
Denny-Brown and Chambers1 described a neurobehavioural
syndrome characterised by avoidance and withdrawal from
visual and tactile stimuli after parietal lobe ablations in the
rhesus monkey. Since their original description, a small number
of human patients with a similar syndrome have been identified2– 4 and the term “rejection behaviour” has been proposed.3
However, the human syndrome remains poorly characterized,
and its pathophysiological basis is unclear. Affected individuals
exhibit different types of avoiding responses that are organised
at different levels of the motor hierarchy. These responses
range from stereotyped flexion–withdrawal movements involving a single limb to elaborate avoiding behaviours. Associated
clinical features are heterogeneous, including abnormalities of
prehensile function,2,4 proprioceptive disturbances,2 cortical visual and auditory disturbances,3 and rejection of food.3 The
majority of cases have had extensive parietal or parietotemporal lesions, frequently bilateral.3,4 Several proposed human
cases of avoiding phenomena have had a sensorimotor syndrome characterised by abnormal posturing of the limbs, cortical sensory deficits, and inability to manipulate objects,4,5–7
and it has been suggested that concurrent cortical sensory

This article contains Supplementary video available online at http://
www.interscience.wiley.com/jpages/0885-3185/suppmat
*Correspondence to: Dr. Martin Rossor, Dementia Research Group,
The National Hospital for Neurology and Neurosurgery, Queen Square,
London WC1N 3BG, United Kingdom.
E-mail: m.rossor@dementia.ion.ucl.ac.uk
Received 26 August 2003; Revised 16 December 2003; Accepted 17
December 2003
Published online 4 March 2004 in Wiley InterScience (www.
interscience.wiley.com). DOI: 10.1002/mds.20059

Movement Disorders, Vol. 19, No. 7, 2004

deficits are necessary for true rejection behaviour to appear in
humans.3 However, it is unclear whether such cases should be
equated with the complex behavioural syndrome described in
the monkey.3 Here, we describe a patient who developed rejection behaviour in the setting of progressive cognitive deterioration associated with stimulus-sensitive myoclonus and a
paucity of cortical sensory signs.

Case Description
A 55-year-old, right-handed, retired painter and decorator
presented with a 5-year history of increasing forgetfulness. He
was unable to recall details of conversations, frequently misplaced items, and failed to keep appointments. During the 12
months before presentation, he had developed involuntary jerks
of the limbs and trunk and found that he was unable to tolerate
being touched by others, especially on the face, upper limbs,
and trunk. His dislike of being touched gave rise to considerable apprehension on being approached: he would attempt to
evade contact if possible, and would push others away if touch
was sustained. Touch was not associated with pain or dysesthesias, and there were no other sensory symptoms; however,
he had noticed a tendency for touch to trigger the limb and
truncal jerks. There was no history of exaggerated startle or
increased sensitivity to sound or light. During the 6 months
before presentation, he had lost approximately a stone in weight
(6.3 kg) and complained of generalised pruritus; there were no
other systemic symptoms. His past history was unremarkable,
and he took no medications. He was a smoker, and consumed
occasional alcohol. His elder brother had been diagnosed with
multiple sclerosis in middle life; there was no other family
history of neurological or psychiatric illness.
On examination, he was severely impaired across a range of
cognitive domains. Mini-Mental State Examination score was
13/30. He was distractible and mildly disinhibited, with impairment of frontal executive functions, including verbal fluency,
proverb interpretation, motor sequencing, and set-switching.
Spontaneous speech was fluent, however, there were phonemic
and regularisation errors both in speaking and reading aloud,
and naming was impaired. Visual and verbal recall were impaired. Calculation and perception of fragmented letters and
pictures were impaired, but there was no evidence of visual
disorientation. Bilateral upper limb dyspraxia was evident for
both imitation of hand postures and pantomiming of learned
actions, however, prehensile functions using either hand were
normal. There were no primitive reflexes. Stimulus-sensitive
multifocal myoclonus was present, involving the brows, ears,
limbs, trunk, and abdominal wall and especially evident on
lying down. Myoclonus could also be provoked by limb movements or by visual approach. There was mild supranuclear
upgaze restriction and bilateral nonsustained gaze-evoked horizontal nystagmus but no palatal myoclonus or cranial nerve
abnormalities. A mild cerebellar dysarthria was present. In the
limbs, muscle bulk was generally reduced without focal wasting or fasciculations, and strength and coordination were normal. Tendon reflexes were normal and plantar responses were
flexor bilaterally. Light touch, pin-prick, joint position, and
vibration sense were normal. Cortical sensory functions, including stereognosis, graphaesthesia, and two-point discrimination were intact, and there was no evidence of sensory
inattention or neglect. There was a mild cerebellar gait ataxia.
The patient displayed a profound intolerance of being
touched, which was most pronounced over the face, mantle

CLINICAL/SCIENTIFIC NOTES
region, trunk, back, and both upper limbs. He became fearful
when approached by either the examiner’s hand or an object
held beyond arm’s reach (such as a tendon hammer) and would
push the hand or object away if touch was sustained. A similar
avoidance response was evident to a sound source (such as the
examiner’s voice) approaching from either side, and whether
from the front or from behind the head. He denied any abnormality in the quality of touch. The symptoms were never
provoked by his own touch or by clothing.
Neuropsychometry confirmed the clinical impression of severe global cognitive impairment; verbal IQ (68) and performance IQ (60) were both defective, and there were deficits of
executive functions, verbal and visual memory, receptive language, and visual perception (affecting higher visual functions
including perception of fragmented pictures but sparing early
visual processing). Full blood count revealed a mild normochromic, normocytic anaemia (haemoglobin, 12.5 g/dl; range,
13–17 g/dl). There was a polyclonal increase in gammaglobulins, but no paraprotein was detected on electrophoresis. Serum
chemistry, renal and liver function, and inflammatory markers
were normal. Serological tests for syphilis, human immunodeficiency virus (HIV), and Lyme disease were negative. Antinuclear factor, anti-neutrophil cytoplasmic antibodies, antiGAD antibodies, and anti–voltage-gated potassium channel
antibodies were negative. Serum B12 was mildly reduced (156;
range ⬎180 ng/L). IgG anti-gliadin antibodies were positive,
however, anti-endomysial antibodies were negative and there
were no other features of malabsorption. On electroencephalography, there was mild slowing of alpha rhythm but no focal
abnormalities and no epileptiform or periodic activity. Magnetic resonance imaging (MRI) of the brain revealed moderate
generalised atrophy of both cerebral hemispheres and cerebellum, without regional predominance, and moderate periventricular and pontine small vessel ischaemic changes; MRI of
the spinal cord was normal. Electrophysiological studies were
normal; in particular, there was no evidence of denervation or
neuromyotonia. Examination of the cerebrospinal fluid (CSF)
revealed an inflammatory picture, with seven normal lymphocytes, and oligoclonal bands in both CSF and serum with an
excess of bands in CSF; concentrations of protein and glucose
in CSF were normal, 14-3-3 protein was negative, and Whipple’s polymerase chain reaction was negative.
Serum immunohistochemistry revealed strongly positive
staining against Purkinje cells and dorsal root ganglia, however, the identity of the antineuronal antibody could not be
confirmed as Western blots were negative. Tumour markers
(prostate-specific antigen, carcinoembryonic antigen, ␤-human
chorionic gonadotropin, ␣-fetoprotein, CA-125, and CA-199)
were not elevated. A chest radiograph suggested a subtle increase in density of the right mid-zone, however, computed
tomography of chest and abdomen was normal and whole-body
fluoro-deoxyglucose positron emission tomography showed no
foci of abnormal uptake.
In view of the high clinical suspicion of a potentially treatable, inflammatory process, a right frontal full-thickness cerebral biopsy, including cortex, white matter, and overlying meninges, was performed. The leptomeninges and dura were
normal. The cortex was mildly hypercellular, due to a diffuse
astrogliosis and an increase in microglial cells; microglia
showed positive CD68 and LCA staining with a dendritic
morphology and were arranged either in focal nodules or diffusely spread in grey matter. Lymphocytic infiltrates were

861

prominent around some cortical vessels, however, there was no
evidence of vasculitis or granulomatous inflammation. There
were no intracellular inclusions. Bielschowsky staining for
neurofibrillary pathology and immunocytochemical staining for
prion proteins, ␤-A4, tau, ␣-synuclein, and ubiquitin were
negative. Although not diagnostic, the inflammatory features,
including activation of microglia with nodule formation and the
presence of perivascular lymphocytic infiltrates, were compatible with paraneoplastic encephalitis.
An empirical trial of intravenous methylprednisolone (500 mg/
day for 5 days) followed by oral prednisolone (80 mg/day for 3
days) produced no benefit. The patient’s condition continued to
deteriorate. Rejection behaviour for feeding developed: the patient
would turn his head to avoid feeding, push the spoon away, or
expel food from the mouth. A paraneoplastic syndrome with
occult primary was considered the most likely diagnosis.

Discussion
In common with previous human cases of the rejection
behaviour syndrome,3 this patient exhibited profound intolerance of touch, withdrawal from tactile, visual, and auditory
approach, and later in the course of the illness, rejection of
food. Unlike some previous cases,2– 4 our patient had no difficulty using his hands to manipulate objects, and there were no
abnormalities of proprioception, cortical visual, or auditory
processing. His communicative capacities were initially preserved, providing an insight into the subjective accompaniments of the rejection behaviour syndrome: unlike patients with
the thalamic syndrome of Dejerine and Roussy,8 he described
touch as strange or unpleasant, rather than painful, and there
was no alteration in the quality of touch per se. Although it was
not possible to assess taste reliably in the later stages of the
illness, it is possible that rejection of food was also a response
to abnormal orolingual somatic sensation.
Associated clinical features, including dyscalculia and deficits
of higher visual perception, implicate the inferior parietal lobes in
the disease process,9 while the well-preserved visuomotor functions suggest that the superior parietal lobes were relatively
spared.10 An inferior parietal localisation would be consistent both
with previous studies of the rejection behaviour syndrome1,3 and
with emerging evidence that the inferior parietal lobes play an
important role in integrating information from multiple sensory
(visual, tactile, and auditory) channels in both humans and nonhuman primates.6,11–15 To our knowledge, the avoiding responses
to auditory approach displayed by our patient have not been
described previously in this syndrome, however, they are in keeping with such a multisensory disturbance.
Stimulus-sensitive multifocal myoclonus was also a prominent feature here. Although the patient was unfortunately unable to tolerate detailed electrophysiological studies, it is likely
that the myoclonus was primarily cortical in origin. Multifocal
jerks occurring spontaneously or elicited by visual or other
sensory stimuli may be associated with diffuse cortical pathological conditions16,17; however, avoiding responses have not
been described in previous cases of cortical myoclonus accompanied by marked stimulus sensitivity. Myoclonus in the
present case could be precipitated by withdrawal movements of
the limbs; the withdrawal response itself was highly organised
and purposeful. With effort, the patient was sometimes able to
tolerate sustained touch for several seconds before withdrawing. Moreover, the rejection of food that developed later in the
illness could not be ascribed to myoclonus. It is, therefore,

Movement Disorders, Vol. 19, No. 7, 2004

862

CLINICAL/SCIENTIFIC NOTES

unlikely that his rejection behaviour syndrome represented an
elaborate form of myoclonus or an aversive response to myoclonus per se. Rather, we suggest that rejection behaviour and
cortical myoclonus should be regarded as dual manifestations
of disturbed cortical information processing.
In their original account of the parietal avoiding syndrome,
Denny-Brown and Chambers1 postulated that positive (exploratory) and negative (withdrawal) motor “tropisms,” mediated by
the parietal and frontal lobes, respectively, exist in equilibrium in
the normal brain and that frontal withdrawal tropisms might be
released after parietal lobe damage. In the present case, the pathological process was diffuse rather than focal and there were no
associated clinical abnormalities of parietal motor or sensory functions: this finding suggests that an intrinsic alteration in cortical
physiology, rather than a frontoparietal disconnection or deafferentation, can give rise to the rejection behaviour syndrome. Inflammatory,18,19 paraneoplastic,19,20 and infectious21 pathological
states that disrupt information transfer between neurones may
produce an electrophysiological lesion that manifests as a complex
movement disorder or encephalopathy. Antibodies against voltage-gated potassium channels have been identified recently18,19
and illustrate one possible mechanism for such an electrophysiological disruption: however, these antibodies were not detected in
the present case. Cortical myoclonus may reflect an intrinsic
hyperexcitability of sensory cortex that results in abnormal processing of sensory traffic.16,17 On the basis of our observations in
the present case, we argue that such abnormal processing may also
give rise to the rejection behaviour syndrome. In certain contexts,
distorted and “noisy” sensory processing can acquire a highly
unpleasant subjective quality22,23: in the somaesthetic domain,
abnormal processing of exogenous tactile signals might provoke
both a cognitive and motor avoiding response. We propose that
rejection behaviour can develop as a consequence of abnormal
sensory integration in the inferior parietal lobe.
Acknowledgments: We thank the patient for participating in this
study. We also thank Dr. Abha Ahuja of the Department of Neuropsychology, National Hospital for Neurology and Neurosurgery, for performing neuropsychometry.

Legends to the Video
The patient fears being touched, recoils from the examiner’s
hand, and pushes the hand away. Bilateral dyspraxia is evident
on attempting to imitate hand positions; however, prehensile
function (here manipulation of coins) is normal. Visual approach elicits synchronous myoclonic jerks affecting the proximal arms and upper body. Spontaneous myoclonus of the
anterior abdominal wall is also prominent.

References
1. Denny-Brown D, Chambers RA. The parietal lobe and behaviour.
Res Publ Assoc Res Nerv Ment Dis 1958;36:35–117.
2. Dehen H, Willer JC, Cambier J. Cutaneous reflexes in the avoidance reaction. Eur Neurol 1981;20:416 – 420.
3. Mori E, Yamadori A. Rejection behaviour: a human homologue of
the abnormal behaviour of Denny-Brown and Chambers’ monkey

Movement Disorders, Vol. 19, No. 7, 2004

with bilateral parietal ablation. J Neurol Neurosurg Psychiatry
1989;52:1260 –1266.
4. Vilensky JA, Gilman S. Positive and negative factors in movement
control: a current review of Denny-Brown’s hypothesis. J Neurol
Sci 1997;151:149 –158.
5. Castaigne P, LaPlane D, Degos JD, Augustin P. Comportement
tonique d’évitement d’origine sous-corticale. Rev Neurol 1971;
124:166 –168.
6. LaPlane D, Meininger V, Bancaud J, Talairach J, Broglin D.
Contribution a l’étude anatomo-clinique des phénomenes d’évitement. Rev Neurol 1979;135:775–787.
7. De Smet Y, Theis C. Phénomène d’évitement provoqué par des
accidents ischémiques transitoires. Rev Neurol 1990;146:705–706.
8. Dejerine J, Roussy G. Le syndrome thalamique. Rev Neurol 1906;
14:521–532.
9. Simon O, Mangin JF, Cohen L, Le Bihan D, Dehaene S. Topographical layout of hand, eye, calculation and language-related
areas in the human parietal lobe. Neuron 2002;33:475– 487.
10. Battaglia-Mayer A, Caminiti R. Optic ataxia as a result of the
breakdown of the global tuning fields of parietal neurones. Brain
2002;125:225–237.
11. Bohlhalter S, Fretz C, Weder B. Hierarchical versus parallel processing in tactile object recognition: a behavioural-neuroanatomical study of aperceptive tactile agnosia. Brain 2002;125:2537–
2548.
12. Bushara KO, Weeks RA, Ishii K, et al. Modality-specific frontal
and parietal areas for auditory and visual spatial localization in
humans. Nat Neurosci 1999;2:759 –766.
13. Warren JD, Zielinsky B, Green GGR, Rauschecker JP, Griffiths
TD. Perception of sound source motion by the human brain.
Neuron 2002;34:139 –148.
14. Banati RB, Goerres GW, Tjoa C, Aggleton JP, Grasby P. The
functional anatomy of visual-tactile integration in man: a study
using positron emission tomography. Neuropsychologia 2000;38:
115–124.
15. Poremba A, Saunders RC, Crane AM, Cook M, Sokoloff L,
Mishkin M. Functional mapping of the primate auditory system.
Science 2003;299:568 –572.
16. Obeso JA, Rothwell JC, Marsden CD. The spectrum of cortical
myoclonus. From reflex jerks to spontaneous motor epilepsy. Brain
1985;108:193–224.
17. Hallett M. Myoclonus: relation to epilepsy. Epilepsia 1985;
26(Suppl. 1):S67–S77.
18. Schott JM, Harkness K, Barnes J, Incisa della Rochetta A, Vincent
A, Rossor MN. Amnesia, cerebral atrophy and autoimmunity: a
treatable dementia associated with voltage-gated potassium channel antibodies. Lancet 2003;361:1266.
19. Buckley C, Oger J, Clover L, et al. Potassium channel antibodies
in two patients with reversible limbic encephalitis. Ann Neurol
2001;50:73–78.
20. Roobol TH, Kazzaz BA, Vecht CJ. Segmental rigidity and spinal
myoclonus as a paraneoplastic syndrome. J Neurol Neurosurg
Psychiatry 1987;50:628 – 631.
21. Warren JD, Kimber TE, Thompson PD. The silent period after
magnetic brain stimulation in generalized tetanus. Muscle Nerve
1999;22:1590 –1592.
22. ffytche DH, Howard RJ. The perceptual consequences of visual
loss: ’positive’ pathologies of vision. Brain 1999;122:1247–1260.
23. Griffiths TD. Musical hallucinosis in acquired deafness: phenomenology and brain substrate. Brain 2000;123:2065–2076.