Eur J Pediatr (1997) 156: 562±564

Ó Springer-Verlag 1997

NEUROPEDIATRICS

C. W. Lam á C. H. Lau á J. C. Williams á Y. W. Chan
L. J. C. Wong

Mitochondrial myopathy, encephalopathy, lactic acidosis
and stroke-like episodes (MELAS) triggered by valproate therapy

Received: 3 September 1996 / Accepted: 31 December 1996

Abstract We report in this study a patient who developed repeated convulsions as a result of valproate
therapy. MELAS (mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes) was
subsequently diagnosed and a nucleotide 3243 A®G
mutation was detected in the mitochondrial DNA. This
mutation predisposes the patient to the detrimental effects of valproate on oxidative phosphorylation.
Conclusion We support the suggestion of Ponchaut
et al. [14] that valproate should not be given to patients
suspected of having mitochondrial diseases. In addition, for patients whose seizures worsen with valproate
therapy, an inborn error of mitochondrial metabolism
should be suspected. The underlying mitochondrial
DNA defects should be sought for family screening and
genetic counselling.
Key words Valproate á Mitochondrial
encephalomyopathy á MELAS syndrome á
Mitochondrial mutation

C. W. Lam á Y. W. Chan
Department of Pathology, Princess Margaret Hospital,
Lai Chi Kok, Hong Kong
C. H. Lau
Department of Paediatrics, Princess Margaret Hospital,
Lai Chi Kok, Hong Kong
J. C. Williams
Division of Medical Genetics, Children's Hospital of Los Angeles,
4650 Sunset Boulevard, Los Angeles, CA 90027 USA
L. J. C. Wong
Molecular Genetics Laboratory,
Children's Hospital of Los Angeles, 4650 Sunset Boulevard,
Los Angeles, CA 90027, USA
C. W. Lam (&)
Department of Chemical Pathology, Prince of Wales Hospital,
Shatin, Hong Kong Tel: (852) 2632 3370; Fax: (852) 2636 5090

Introduction

Recent studies indicated that valproate (2-propylpentanoate) interferes with intermediary metabolism in both
healthy subjects and in patients with latent inborn errors
of metabolism [7, 10]. In rats, Rumbach et al. [16]
showed that valproate at therapeutic concentrations
modi®ed the structural organization of the mitochondrial membrane by changing the conformation of the
membrane proteins. It also a€ects the function of the
mitochondria by depleting cytochrome aa3, resulting in
a decrease in mitochondrial respiration [13]. In addition,
Chabrol et al. [1] observed in a patient that valproate
decreased cytochrome c oxidase activity. However,
whether there were underlying genetic defects in these
patients is unknown. Thus it is dicult to determine
whether valproate per se causes mitochondrial disease or
if it merely augments a pre-existing condition [17]. The
di€erence between acquired and genetic causes is important for prognostic assessment and for genetic
counselling. In this report, we describe a patient who
had mitochondrial myopathy, encephalopathy, lactic
acidosis and stroke-like episodes (MELAS), conditions
which became aggravated by valproate therapy. Genetic
studies revealed a nucleotide 3243 A®G mutation in the
mitochondrial tRNALeu(UUR) gene of this patient, which
is familial in origin.

Case report
A 12-year-old boy with mild mental retardation presented with
headache, drowsiness, and right-sided focal convulsion. About
1 year later, he experienced a similar seizure and was then treated
with sodium valproate 200 mg thrice daily. Eight days after initiation of valproate, the patient developed right hemiparesis, hypotonia and had two seizures. The serum valproate concentration
measured at that time was 396 lmol/l (therapeutic range: 347±
693 lmol/l). Plasma ammonium and serum transaminases were
normal. Sodium valproate was increased to 300 mg thrice daily and
carbamazepine was also started. However, there was no clinical
improvement and the patient developed two more episodes of

563
convulsions. Because of the idiosyncratic drug reactions, valproate
was quickly tapered. Vitamins B1 and B2 were also started. The
convulsions stopped and the patient's condition became stable.
Metabolic stroke and MELAS syndrome were suspected and
blood for lactate and pyruvate drawn. Deproteinized blood lactate
(L) was 2.8 mmol/L (reference range 0.5±1.3 mmol/L) and pyruvate (P) was 207 nmol/L (reference range 57±114 nmol/L) with a
L/P ratio of 14 (reference range: 6±14). Brain CT scan showed the
presence of a left parieto-occipital infarct and bilateral basal ganglia calci®cation. Muscle biopsy showed presence of ragged-red
®bres on modi®ed Gomori-trichrome stain. Electron microscopy
showed increased numbers of mitochondria and atypical mitochondria in the subsarcolemmal region, some with inclusion bodies.
Since the clinical features and the muscle biopsy ®ndings strongly
suggested MELAS syndrome, molecular mutation analysis was
performed to con®rm the diagnosis.

Material and methods
Mitochondrial DNA analysis
Genomic DNA was extracted from peripheral blood samples and
formalin-®xed paran-embedded sections of the muscle biopsy
tissue were performed as described [9]. The primers used for PCR
were 5¢ CCTCCCTGTACGAAAGGAC3¢ and 3¢ CGCTAATCTTACCCATGTTAC5¢, which were homologous to heavy chain
nucleotide position 3116±3134 and light chain nucleotide position
3353±3333 of mitochondrial DNA sequence, respectively. The size
of the PCR product was 238 bp. Digestion of the PCR product
with 10 units of restriction enzyme HaeIII at 37°C for 2 h produced
DNA fragments of 169, 37, and 32 bp. The presence of the nt 3243
A®G mutation generates an additional HaeIII restriction site
splitting the 169 bp fragment into a 97 and a 72 bp fragment. The
DNA fragments were separated by 12% polyacrylamide gel electrophoresis and the nt3243 A®G heteroplasmy was quantitated
according to the procedure of Ciafaloni et al. [2].

Results

A point mutation at nucleotide position 3243 of mitochondrial DNA in the patient was present in 27% of
peripheral blood leucocytes and in 84% muscle tissue.
Family members of the patient were also examined for
this mutation. The results are summarized in Fig. 1.
Discussion

Mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes (MELAS) is a maternally
inherited disease. The clinical features of MELAS syndrome were ®rst described by Pavlakis et al. [11]. It was
found to be associated with respiratory chain disorders,
particularly complex I (NADH coenzyme Q reductase)
[8]. The genetic defect was subsequently found to be a
nt3243 A®G mutation in the mitochondrial
tRNALeu(UUR) gene [5]. This mutation accounts for 80%
of MELAS patients [4].
Our patient presented with a focal convulsion and
was treated with sodium valproate. This treatment,
contrary to expectation, enhanced the frequency of
convulsions. In addition, valproate administration apparently triggered the development of the right hemi-

Fig. 1. A Pedigree of the family with MELAS. The solid symbol
denotes the patient with MELAS. The numbers below the symbol
represent the amount of mutant mitochondrial DNA in blood.
B Restriction enzyme analysis of the PCR products from the MELAS
patient and his family members. Digestion of normal mitochondrial
DNA with restriction enzyme HaeIII generates three fragments of
169, 37, and 32 bp, as shown in lane C (control); the presence of the
nt3243 A®G mutation creates an additional HaeIII site that causes
the 169 bp fragment to be cut into 97 and 72 bp fragments. U uncut
PCR products; C normal control

paresis. Indeed, when valproate was tapered, the
convulsions stopped and his clinical condition became
stable. Although the dramatic improvement in our patient's condition may be attributed to the vitamins given
in the treatment regime [12], no controlled study has
clearly proven the bene®t of such treatment [18]. Dichloroacetate which was proved to be e€ective in im-

564

proving mitochondrial function was not used in our
patient [3]. Thus, it is evident that valproate directly
triggered the mitochondrial myopathy in our patient.
While Rumbach et al. [15] showed that valproate
inhibits oxidative phosphorylation in hepatic and cerebral mitochondria, Ponchaut et al. [13] demonstrated
that valproate impaired the proton pumping activity of
complex IV (cytochrome c oxidase) in the respiratory
chain. This was observed in a patient who subsequently
developed hepatic failure [1]. In this patient, while cytochrome oxidase activity was markedly decreased in the
circulating lymphocytes, liver, and cultured skin ®broblasts, no gross alteration of mitochondrial DNA was
detected by Southern blot. However, point mutations in
the mitochondrial DNA were not investigated. Given
the crucial role of complex IV in the respiratory chain, it
is not surprising that valproate can precipitate severe
symptomatology of MELAS by further suppressing the
constitutively de®cient complex IV activity, which occurs in 50% of MELAS patients [4]. In addition, this
valproate-induced enzyme suppression can exceed the
metabolic threshold for phenotypic expression in tissues
having a lower amount of heteroplasmy. Since valproate
normally inhibits oxidative phosphorylation [6], decreased mitochondrial enzymic activity determined
during valproate therapy is not sucient for a de®nitive
diagnosis of mitochondrial diseases. In this situation,
molecular genetic techniques should be used to con®rm
the diagnosis.
Acknowledgements We are indebted to L.K. Lau for the examination of the muscle biopsy, and Dinithi Senadheera for the excellent technical assistance.

References
1. Chabrol B, Mancini J, Chretien D, Rustin P, Munnich A,
Pinsard N (1994) Valproate-induced hepatic failure in a case of
cytochrome c oxidase de®ciency. Eur J Pediatr 153:133±135
2. Ciafaloni E, Ricci E, Shanske S et al. (1992) MELAS: clinical
features, biochemistry, and molecular genetics. Ann Neurol
31:391±398
3. De Stefano N, Matthews PM, Ford B et al. (1995) Short-term
dichloroacetate treatment improves indices of cerebral metabolism in patients with mitochondrial disorders. Neurology
45:1193±1198

4. Goto Y, Horai S, Matsuoka T et al. (1992) Mitochondrial
myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS): a correlative study of the clinical features and
mitochondrial DNA mutation. Neurology 42:545±550
5. Goto Y, Nonaka I, Horai S (1990) A mutation in the
tRNALeu(UUR) gene associated with the MELAS subgroup of
mitochondrial encephalomyopathies. Nature 384:651±653
6. Haas R, Stumpf DA, Parks JK, Eguren L (1981) Inhibitory
e€ects of sodium valproate on oxidative phosphorylation.
Neurology 31:1473±1476
7. Honeycutt D, Callahan K, Rutledge L, Evans B (1992) Heterozygote ornithine transcarbamylase de®ciency presenting as
symptomatic hyperammonemia during initiation of valproate
therapy. Neurology 42:666±667
8. Kobayashi Y, Morishita H, Sugiyama N et al. (1987) Two cases
of NADH-coenzyme Q reductase de®ciency: relationship to
MELAS syndrome. J Pediatr 110:223±227
9. Lam CW, Jain K, Chan KY, Silva DK, Chan YW, Wong LJC
(1995) Diagnosis of mitochondrial encephalomyopathy, lactic
acidosis, and stroke-like episodes in a Chinese family by PCR/
restriction enzyme analysis. J Clin Pathol Mol Pathol 48:M
285±288
10. Leao M (1995) Valproate as a cause of hyperammonemia in
heterozygotes with ornithine-transcarbamylase de®ciency.
Neurology 45:593±594
11. Pavlakis SG, Phillips PC, DiMauro S, DeVivo DC, Rowland
LP (1984) Mitochondrial myopathy, encephalopathy, lactic
acidosis and strokelike episodes: a distinctive clinical syndrome.
Ann Neurol 16:484±488
12. Penn AM, Lee JW, Thuillier P et al. (1992) MELAS syndrome
with mitochondrial tRNALeu(UUR) mutation: correlation of
clinical state, nerve conduction, and muscle 31P magnetic resonance spectroscopy during treatment with nicotinamide and
ribo¯avin. Neurology 42:2147±2152
13. Ponchaut S, Van Hoof F, Veitch K (1992) Cytochrome aa3
depletion is the cause of the de®cient mitochondrial respiration
induced by chronic valproate administration. Biochem Pharmacol 43:644±647
14. Ponchaut S, Van Hoof F, Veitch K (1995) Valproate and cytochrome c oxidase de®ciency. Eur J Pediatr 154:79
15. Rumbach L, Warter JM, Rendon A, Marescaux C, Micheletti
G, Waksman A (1983) Inhibition of oxidative phosphorylation
in hepatic and cerebral mitochondria of sodium valproatetreated rats. J Neurol Sci 61:471±523
16. Rumbach L, Mutet C, Cremel G et al. (1986) E€ects of sodium
valproate on mitochondrial membranes: electron paramagnetic
resonance and transmembrane protein movement studies. Mol
Pharmacol 30:270±273
17. Schapira AH, Cooper JN (1994) Inborn and induced defects of
the mitochondrial respiratory chain. Biochem Soc Trans
22:996±1001
18. Walker UA, Byrne E (1995) The therapy of respiratory chain
encephalomyopathy: a critical review of the past and current
perspective. Acta Neurol Scand 92:273±280